Incidental Mutation 'FR4304:Catsper2'
ID 510961
Institutional Source Beutler Lab
Gene Symbol Catsper2
Ensembl Gene ENSMUSG00000033486
Gene Name cation channel, sperm associated 2
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # FR4304 ()
Quality Score 217.468
Status Not validated
Chromosome 2
Chromosomal Location 121223112-121244273 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) CAT to CATTAT at 121228263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038073] [ENSMUST00000154604]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000038073
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146521
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null male mice are infertile due to a sperm motility defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 136 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Homo
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
4930447C04Rik AAGT A 12: 72,928,061 (GRCm39) probably benign Homo
Acbd4 CAG CAGACTAG 11: 102,994,931 (GRCm39) probably null Homo
Ahdc1 CT CTCTT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTGCT 7: 80,727,510 (GRCm39) probably benign Het
Anapc4 C T 5: 53,021,868 (GRCm39) T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,591,163 (GRCm39) probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,415,050 (GRCm39) probably benign Het
Apol6 TTGT TTGTCTGT 15: 76,935,636 (GRCm39) probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,232,736 (GRCm39) probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,063,601 (GRCm39) probably null Het
Blm CT CTACGT 7: 80,113,521 (GRCm39) probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,162,667 (GRCm39) probably benign Het
Btnl10 GA GAATA 11: 58,814,756 (GRCm39) probably benign Homo
Cacna1f AGG AGGCGG X: 7,486,300 (GRCm39) probably benign Het
Calhm3 CG CGG 19: 47,140,335 (GRCm39) probably null Homo
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Ccdc15 AC ACTTTCC 9: 37,226,453 (GRCm39) probably null Het
Ccdc162 T C 10: 41,432,117 (GRCm39) D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,511,021 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,240,871 (GRCm39) probably benign Het
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,306,677 (GRCm39) probably benign Homo
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap74 A G 4: 155,500,217 (GRCm39) D21G possibly damaging Homo
Cgref1 T TCTA 5: 31,091,124 (GRCm39) probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,099,107 (GRCm39) probably benign Het
Cnpy3 TCC TCCACC 17: 47,047,672 (GRCm39) probably benign Het
Cnpy3 TCC TCCCCC 17: 47,047,669 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,080,415 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,457 (GRCm39) probably benign Het
Dhx37 CTGG C 5: 125,504,594 (GRCm39) probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 TCC TCCCCC 2: 130,612,668 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dst C A 1: 34,240,045 (GRCm39) S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,763,728 (GRCm39) probably benign Homo
Ermn TTC TTCCTC 2: 57,938,090 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,098 (GRCm39) probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,243 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,240 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gm4340 CAG CAGAAG 10: 104,031,933 (GRCm39) probably benign Het
Gm5114 T C 7: 39,060,529 (GRCm39) R107G probably benign Het
Gm5114 A C 7: 39,060,530 (GRCm39) H106Q probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,431,173 (GRCm39) probably null Het
Ifi203 C T 1: 173,755,894 (GRCm39) probably benign Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Il17rd CGG CGGTGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,179,975 (GRCm39) probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,013 (GRCm39) probably benign Het
Ipo9 CCT CCTACT 1: 135,314,017 (GRCm39) probably null Het
Isg20l2 AAG AAGCAG 3: 87,839,019 (GRCm39) probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,520,764 (GRCm39) probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,280,100 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,426 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,427 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lrch1 A T 14: 75,057,005 (GRCm39) C241S possibly damaging Het
Lrit3 G GCTT 3: 129,582,468 (GRCm39) probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,532,755 (GRCm39) probably benign Homo
Mast4 T TTTC 13: 102,871,370 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Muc21 T G 17: 35,933,013 (GRCm39) probably benign Homo
Noc2l TGC TGCAGC 4: 156,324,553 (GRCm39) probably benign Het
Nrg3 G GACATTT 14: 38,119,230 (GRCm39) probably benign Homo
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Homo
Patl2 GCT GCTTCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,006,685 (GRCm39) probably null Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,468,290 (GRCm39) probably benign Het
Prkd3 G T 17: 79,283,249 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Het
Prr13 TCC TCCCCC 15: 102,370,612 (GRCm39) probably benign Homo
Prrc2b G A 2: 32,111,179 (GRCm39) A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,891,421 (GRCm39) probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,557,632 (GRCm39) probably benign Homo
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Sry GTG GTGCTG Y: 2,662,837 (GRCm39) probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 98,110,111 (GRCm39) probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,635,085 (GRCm39) probably null Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Sytl1 CTCT C 4: 132,984,304 (GRCm39) probably benign Homo
Tcof1 AGC AGCGGC 18: 60,968,814 (GRCm39) probably benign Het
Tdpoz2 T TCA 3: 93,558,922 (GRCm39) probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,796,421 (GRCm39) probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Ticrr ATT ATTTTT 7: 79,344,059 (GRCm39) probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tnfrsf9 T TGCC 4: 151,018,852 (GRCm39) probably benign Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CA CAGTA 11: 94,105,303 (GRCm39) probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,877,587 (GRCm39) probably benign Homo
Tsbp1 A AGCC 17: 34,679,029 (GRCm39) probably benign Het
Tsbp1 GC GCATC 17: 34,679,051 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,197,784 (GRCm39) probably benign Het
Vars1 TGG TGGAGTCCTGGGCGG 17: 35,234,965 (GRCm39) probably benign Homo
Vmn1r171 C T 7: 23,332,105 (GRCm39) A110V probably benign Het
Vmn2r31 G T 7: 7,387,607 (GRCm39) Q655K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 CG CGAGATGTGTG 14: 75,561,050 (GRCm39) probably benign Het
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,561,043 (GRCm39) probably benign Het
Zfp282 GGC GGCCGC 6: 47,881,731 (GRCm39) probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,013,456 (GRCm39) probably benign Het
Zfp459 TGA TGAGCGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp831 CCT CCTGCT 2: 174,487,274 (GRCm39) probably benign Het
Other mutations in Catsper2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Catsper2 APN 2 121,228,373 (GRCm39) splice site probably benign
IGL01830:Catsper2 APN 2 121,237,843 (GRCm39) missense probably damaging 1.00
IGL03243:Catsper2 APN 2 121,237,300 (GRCm39) missense probably benign 0.08
IGL03247:Catsper2 APN 2 121,240,681 (GRCm39) missense probably benign 0.03
IGL03342:Catsper2 APN 2 121,237,217 (GRCm39) missense probably damaging 0.99
FR4304:Catsper2 UTSW 2 121,228,023 (GRCm39) nonsense probably null
FR4342:Catsper2 UTSW 2 121,228,274 (GRCm39) utr 3 prime probably benign
FR4589:Catsper2 UTSW 2 121,228,260 (GRCm39) utr 3 prime probably benign
FR4737:Catsper2 UTSW 2 121,228,021 (GRCm39) utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121,228,263 (GRCm39) utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121,228,260 (GRCm39) utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121,228,023 (GRCm39) utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121,228,276 (GRCm39) utr 3 prime probably benign
R1463:Catsper2 UTSW 2 121,236,927 (GRCm39) missense probably damaging 1.00
R1686:Catsper2 UTSW 2 121,230,523 (GRCm39) critical splice donor site probably null
R2006:Catsper2 UTSW 2 121,236,838 (GRCm39) nonsense probably null
R2163:Catsper2 UTSW 2 121,230,656 (GRCm39) missense probably damaging 1.00
R4543:Catsper2 UTSW 2 121,237,890 (GRCm39) nonsense probably null
R4888:Catsper2 UTSW 2 121,227,604 (GRCm39) splice site probably null
R5121:Catsper2 UTSW 2 121,227,604 (GRCm39) splice site probably null
R5323:Catsper2 UTSW 2 121,237,216 (GRCm39) missense probably damaging 1.00
R5518:Catsper2 UTSW 2 121,236,844 (GRCm39) missense possibly damaging 0.69
R5605:Catsper2 UTSW 2 121,227,533 (GRCm39) missense possibly damaging 0.91
R6521:Catsper2 UTSW 2 121,237,288 (GRCm39) missense probably damaging 1.00
R6531:Catsper2 UTSW 2 121,230,261 (GRCm39) missense possibly damaging 0.67
R7055:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R7138:Catsper2 UTSW 2 121,227,544 (GRCm39) missense possibly damaging 0.85
R7240:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R7247:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R7686:Catsper2 UTSW 2 121,227,937 (GRCm39) splice site probably null
R8385:Catsper2 UTSW 2 121,240,621 (GRCm39) missense possibly damaging 0.46
R8426:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R9086:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R9584:Catsper2 UTSW 2 121,230,301 (GRCm39) missense probably damaging 0.99
R9616:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R9646:Catsper2 UTSW 2 121,228,053 (GRCm39) utr 3 prime probably benign
R9708:Catsper2 UTSW 2 121,237,321 (GRCm39) missense possibly damaging 0.46
RF028:Catsper2 UTSW 2 121,228,207 (GRCm39) utr 3 prime probably benign
Z1176:Catsper2 UTSW 2 121,237,866 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGATGGCTTTTCTCAGGATAG -3'
(R):5'- TTAAAGCTGTAAGCCAAAGCC -3'

Sequencing Primer
(F):5'- CTCAGGATAGCTTTTCTCAGGATG -3'
(R):5'- CTGTAAGCCAAAGCCTTAGGGAC -3'
Posted On 2018-04-05