Incidental Mutation 'FR4304:Zfp462'
ID 510977
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Name zinc finger protein 462
Synonyms 9430078C22Rik, Zfpip, Gt4-2
Accession Numbers
Essential gene? Probably essential (E-score: 0.881) question?
Stock # FR4304 ()
Quality Score 217.576
Status Not validated
Chromosome 4
Chromosomal Location 54945048-55083563 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCACC to GCCACCTCAGCCACAACCACC at 55009757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
AlphaFold B1AWL2
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098070
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 136 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Homo
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
4930447C04Rik AAGT A 12: 72,928,061 (GRCm39) probably benign Homo
Acbd4 CAG CAGACTAG 11: 102,994,931 (GRCm39) probably null Homo
Ahdc1 CT CTCTT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTGCT 7: 80,727,510 (GRCm39) probably benign Het
Anapc4 C T 5: 53,021,868 (GRCm39) T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,591,163 (GRCm39) probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,415,050 (GRCm39) probably benign Het
Apol6 TTGT TTGTCTGT 15: 76,935,636 (GRCm39) probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,232,736 (GRCm39) probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,063,601 (GRCm39) probably null Het
Blm CT CTACGT 7: 80,113,521 (GRCm39) probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,162,667 (GRCm39) probably benign Het
Btnl10 GA GAATA 11: 58,814,756 (GRCm39) probably benign Homo
Cacna1f AGG AGGCGG X: 7,486,300 (GRCm39) probably benign Het
Calhm3 CG CGG 19: 47,140,335 (GRCm39) probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,228,023 (GRCm39) probably null Homo
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Ccdc15 AC ACTTTCC 9: 37,226,453 (GRCm39) probably null Het
Ccdc162 T C 10: 41,432,117 (GRCm39) D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,511,021 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,240,871 (GRCm39) probably benign Het
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,306,677 (GRCm39) probably benign Homo
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap74 A G 4: 155,500,217 (GRCm39) D21G possibly damaging Homo
Cgref1 T TCTA 5: 31,091,124 (GRCm39) probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,099,107 (GRCm39) probably benign Het
Cnpy3 TCC TCCACC 17: 47,047,672 (GRCm39) probably benign Het
Cnpy3 TCC TCCCCC 17: 47,047,669 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,080,415 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,457 (GRCm39) probably benign Het
Dhx37 CTGG C 5: 125,504,594 (GRCm39) probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 TCC TCCCCC 2: 130,612,668 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dst C A 1: 34,240,045 (GRCm39) S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,763,728 (GRCm39) probably benign Homo
Ermn TTC TTCCTC 2: 57,938,090 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,098 (GRCm39) probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,243 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,240 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,031,933 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gm5114 T C 7: 39,060,529 (GRCm39) R107G probably benign Het
Gm5114 A C 7: 39,060,530 (GRCm39) H106Q probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,431,173 (GRCm39) probably null Het
Ifi203 C T 1: 173,755,894 (GRCm39) probably benign Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Il17rd CGG CGGTGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,179,975 (GRCm39) probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,013 (GRCm39) probably benign Het
Ipo9 CCT CCTACT 1: 135,314,017 (GRCm39) probably null Het
Isg20l2 AAG AAGCAG 3: 87,839,019 (GRCm39) probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,520,764 (GRCm39) probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,280,100 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,426 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,427 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lrch1 A T 14: 75,057,005 (GRCm39) C241S possibly damaging Het
Lrit3 G GCTT 3: 129,582,468 (GRCm39) probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,532,755 (GRCm39) probably benign Homo
Mast4 T TTTC 13: 102,871,370 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Muc21 T G 17: 35,933,013 (GRCm39) probably benign Homo
Noc2l TGC TGCAGC 4: 156,324,553 (GRCm39) probably benign Het
Nrg3 G GACATTT 14: 38,119,230 (GRCm39) probably benign Homo
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Homo
Patl2 GCT GCTTCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,006,685 (GRCm39) probably null Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,468,290 (GRCm39) probably benign Het
Prkd3 G T 17: 79,283,249 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Het
Prr13 TCC TCCCCC 15: 102,370,612 (GRCm39) probably benign Homo
Prrc2b G A 2: 32,111,179 (GRCm39) A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,891,421 (GRCm39) probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,557,632 (GRCm39) probably benign Homo
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Sry GTG GTGCTG Y: 2,662,837 (GRCm39) probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 98,110,111 (GRCm39) probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,635,085 (GRCm39) probably null Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Sytl1 CTCT C 4: 132,984,304 (GRCm39) probably benign Homo
Tcof1 AGC AGCGGC 18: 60,968,814 (GRCm39) probably benign Het
Tdpoz2 T TCA 3: 93,558,922 (GRCm39) probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,796,421 (GRCm39) probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Ticrr ATT ATTTTT 7: 79,344,059 (GRCm39) probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tnfrsf9 T TGCC 4: 151,018,852 (GRCm39) probably benign Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CA CAGTA 11: 94,105,303 (GRCm39) probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,877,587 (GRCm39) probably benign Homo
Tsbp1 A AGCC 17: 34,679,029 (GRCm39) probably benign Het
Tsbp1 GC GCATC 17: 34,679,051 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,197,784 (GRCm39) probably benign Het
Vars1 TGG TGGAGTCCTGGGCGG 17: 35,234,965 (GRCm39) probably benign Homo
Vmn1r171 C T 7: 23,332,105 (GRCm39) A110V probably benign Het
Vmn2r31 G T 7: 7,387,607 (GRCm39) Q655K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 CG CGAGATGTGTG 14: 75,561,050 (GRCm39) probably benign Het
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,561,043 (GRCm39) probably benign Het
Zfp282 GGC GGCCGC 6: 47,881,731 (GRCm39) probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,013,456 (GRCm39) probably benign Het
Zfp459 TGA TGAGCGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp831 CCT CCTGCT 2: 174,487,274 (GRCm39) probably benign Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55,011,483 (GRCm39) splice site probably null
IGL00421:Zfp462 APN 4 55,023,576 (GRCm39) missense probably benign 0.00
IGL00899:Zfp462 APN 4 55,007,732 (GRCm39) missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55,013,181 (GRCm39) missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55,008,912 (GRCm39) missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55,008,586 (GRCm39) missense probably benign 0.20
IGL01862:Zfp462 APN 4 55,023,441 (GRCm39) missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55,012,138 (GRCm39) missense probably benign 0.04
IGL02029:Zfp462 APN 4 55,079,395 (GRCm39) splice site probably benign
IGL02338:Zfp462 APN 4 55,010,292 (GRCm39) missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55,012,986 (GRCm39) missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55,060,236 (GRCm39) missense probably null 1.00
IGL02815:Zfp462 APN 4 55,051,303 (GRCm39) missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55,080,785 (GRCm39) missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,761 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
P0035:Zfp462 UTSW 4 55,009,086 (GRCm39) missense probably benign
R0052:Zfp462 UTSW 4 55,011,762 (GRCm39) missense probably benign 0.03
R0143:Zfp462 UTSW 4 55,023,402 (GRCm39) splice site probably benign
R0145:Zfp462 UTSW 4 55,010,529 (GRCm39) missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55,079,314 (GRCm39) missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55,008,768 (GRCm39) missense probably benign
R0359:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55,010,534 (GRCm39) missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55,011,951 (GRCm39) missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55,013,000 (GRCm39) missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55,060,046 (GRCm39) missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55,007,667 (GRCm39) missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55,009,002 (GRCm39) missense probably benign
R1541:Zfp462 UTSW 4 55,008,928 (GRCm39) missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55,013,489 (GRCm39) missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55,010,010 (GRCm39) missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55,010,830 (GRCm39) missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55,008,496 (GRCm39) missense probably benign 0.00
R2148:Zfp462 UTSW 4 55,013,670 (GRCm39) missense probably benign 0.01
R2179:Zfp462 UTSW 4 55,009,524 (GRCm39) missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55,013,712 (GRCm39) missense probably benign
R2352:Zfp462 UTSW 4 55,008,313 (GRCm39) missense probably null
R2566:Zfp462 UTSW 4 55,008,522 (GRCm39) missense probably benign 0.00
R3879:Zfp462 UTSW 4 55,060,095 (GRCm39) missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55,012,402 (GRCm39) missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55,008,411 (GRCm39) missense probably benign 0.00
R4413:Zfp462 UTSW 4 55,012,672 (GRCm39) missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55,011,889 (GRCm39) missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55,012,981 (GRCm39) missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55,009,349 (GRCm39) missense probably benign
R4682:Zfp462 UTSW 4 55,011,376 (GRCm39) missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55,008,612 (GRCm39) missense probably benign
R4744:Zfp462 UTSW 4 55,011,598 (GRCm39) missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55,013,476 (GRCm39) missense probably benign 0.00
R4819:Zfp462 UTSW 4 55,060,044 (GRCm39) missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55,012,213 (GRCm39) missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55,010,668 (GRCm39) missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55,009,444 (GRCm39) missense probably benign 0.02
R4891:Zfp462 UTSW 4 55,060,055 (GRCm39) missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55,051,204 (GRCm39) missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55,010,667 (GRCm39) missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55,016,986 (GRCm39) splice site probably null
R5173:Zfp462 UTSW 4 55,011,115 (GRCm39) missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55,016,887 (GRCm39) missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55,012,299 (GRCm39) missense probably benign
R5314:Zfp462 UTSW 4 55,013,178 (GRCm39) missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55,060,077 (GRCm39) missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55,009,818 (GRCm39) missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55,050,281 (GRCm39) missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55,013,464 (GRCm39) missense probably benign 0.01
R5775:Zfp462 UTSW 4 55,010,590 (GRCm39) missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55,023,573 (GRCm39) missense probably benign 0.01
R6280:Zfp462 UTSW 4 55,010,253 (GRCm39) missense probably benign 0.00
R6325:Zfp462 UTSW 4 55,080,680 (GRCm39) missense probably benign 0.04
R6542:Zfp462 UTSW 4 55,023,433 (GRCm39) missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55,012,324 (GRCm39) splice site probably null
R6663:Zfp462 UTSW 4 55,008,933 (GRCm39) missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55,012,326 (GRCm39) missense probably benign 0.01
R6889:Zfp462 UTSW 4 55,007,671 (GRCm39) missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55,009,544 (GRCm39) missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55,007,775 (GRCm39) missense probably benign 0.25
R6988:Zfp462 UTSW 4 55,080,716 (GRCm39) missense probably benign 0.00
R7131:Zfp462 UTSW 4 55,009,380 (GRCm39) missense probably benign
R7151:Zfp462 UTSW 4 55,051,271 (GRCm39) missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55,008,908 (GRCm39) missense probably benign
R7741:Zfp462 UTSW 4 55,008,637 (GRCm39) missense probably benign 0.00
R7750:Zfp462 UTSW 4 55,016,958 (GRCm39) missense probably benign 0.06
R7812:Zfp462 UTSW 4 55,008,509 (GRCm39) missense probably benign 0.00
R7863:Zfp462 UTSW 4 55,007,747 (GRCm39) missense probably benign
R7898:Zfp462 UTSW 4 55,012,995 (GRCm39) missense probably damaging 0.98
R7993:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R7995:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55,073,106 (GRCm39) critical splice donor site probably null
R8394:Zfp462 UTSW 4 55,011,862 (GRCm39) missense probably damaging 1.00
R8669:Zfp462 UTSW 4 55,051,313 (GRCm39) missense probably damaging 0.99
R8877:Zfp462 UTSW 4 55,011,097 (GRCm39) missense probably damaging 0.98
R8980:Zfp462 UTSW 4 55,009,681 (GRCm39) unclassified probably benign
R9023:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed probably null 0.00
R9243:Zfp462 UTSW 4 55,009,595 (GRCm39) nonsense probably null
R9378:Zfp462 UTSW 4 55,011,510 (GRCm39) missense probably benign 0.00
R9417:Zfp462 UTSW 4 55,016,988 (GRCm39) missense probably benign 0.26
R9476:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9510:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9610:Zfp462 UTSW 4 55,009,545 (GRCm39) missense possibly damaging 0.73
R9628:Zfp462 UTSW 4 55,009,423 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTACGAGAGCTCCAGCATC -3'
(R):5'- GAGGTCTGACTTTTCTTCACAGTG -3'

Sequencing Primer
(F):5'- TTACGAGAGCTCCAGCATCAATGG -3'
(R):5'- ATCCGTCTCATTTTCCAGTGGTAGG -3'
Posted On 2018-04-05