Incidental Mutation 'FR4304:Cttnbp2'
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #FR4304 ()
Quality Score217.468
Status Not validated
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATTGCTG to ATTGCTGTTGCTG at 18367458 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416

low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146775
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416

low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Homo
4930402H24Rik TCC TCCCCC 2: 130,770,748 probably benign Het
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4930447C04Rik AAGT A 12: 72,881,287 probably benign Homo
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
Acbd4 CAG CAGACTAG 11: 103,104,105 probably null Homo
Ahdc1 CT CTCTT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTGCT 7: 81,077,762 probably benign Het
Anapc4 C T 5: 52,864,526 T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,924 probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,683,847 probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,281,997 probably benign Het
Apol6 TTGT TTGTCTGT 15: 77,051,436 probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,405,168 probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,126,791 probably null Het
BC051142 A AGCC 17: 34,460,055 probably benign Het
BC051142 GC GCATC 17: 34,460,077 probably benign Het
Blm CT CTACGT 7: 80,463,773 probably null Homo
Btnl10 GA GAATA 11: 58,923,930 probably benign Homo
Cacna1f AGG AGGCGG X: 7,620,061 probably benign Het
Calhm3 CG CGG 19: 47,151,896 probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,397,542 probably null Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Ccdc15 AC ACTTTCC 9: 37,315,157 probably null Het
Ccdc162 T C 10: 41,556,121 D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,561,021 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,274,612 probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,486,315 probably benign Homo
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap74 A G 4: 155,415,760 D21G possibly damaging Homo
Cgref1 T TCTA 5: 30,933,780 probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,122,144 probably benign Het
Cnpy3 TCC TCCCCC 17: 46,736,743 probably benign Het
Cnpy3 TCC TCCACC 17: 46,736,746 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,189,589 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Dhx37 CTGG C 5: 125,427,530 probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dst C A 1: 34,200,964 S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,775,290 probably benign Homo
Ermn TTC TTCCTC 2: 58,048,078 probably benign Het
Ermn CTT CTTGTT 2: 58,048,086 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,094 probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,097 probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,100 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,196,072 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm5114 T C 7: 39,411,105 R107G probably benign Het
Gm5114 A C 7: 39,411,106 H106Q probably benign Het
Gm9573 T G 17: 35,622,121 probably benign Homo
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,120,281 probably null Het
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Ifi203 C T 1: 173,928,328 probably benign Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Il17rd CGG CGGTGG 14: 27,082,680 probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,125,826 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTACT 1: 135,386,279 probably null Het
Isg20l2 AAG AAGCAG 3: 87,931,712 probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,315,766 probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,389,274 probably benign Het
Las1l GAG GAGCAG X: 95,940,820 probably benign Het
Las1l AGG AGGCGG X: 95,940,821 probably benign Het
Lrch1 A T 14: 74,819,565 C241S possibly damaging Het
Lrit3 G GCTT 3: 129,788,819 probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,621,459 probably benign Homo
Mast4 T TTTC 13: 102,734,862 probably benign Het
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Noc2l TGC TGCAGC 4: 156,240,096 probably benign Het
Nrg3 G GACATTT 14: 38,397,273 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Het
Patl2 GCT GCTTCT 2: 122,126,135 probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Homo
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,479,858 probably benign Het
Prkd3 G T 17: 78,975,820 probably null Homo
Prr13 TCC TCCCCC 15: 102,462,177 probably benign Homo
Prrc2b G A 2: 32,221,167 A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,914,458 probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,591,198 probably benign Homo
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Sry GTG GTGCTG Y: 2,662,837 probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 99,066,505 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,727,664 probably null Het
Sytl1 CTCT C 4: 133,256,993 probably benign Homo
Tcof1 AGC AGCGGC 18: 60,835,742 probably benign Het
Tdpoz2 T TCA 3: 93,651,615 probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,648,302 probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Ticrr ATT ATTTTT 7: 79,694,311 probably benign Homo
Tnfrsf9 T TGCC 4: 150,934,395 probably benign Homo
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 CA CAGTA 11: 94,214,477 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,993,387 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,306,958 probably benign Het
Vars TGG TGGAGTCCTGGGCGG 17: 35,015,989 probably benign Homo
Vmn1r171 C T 7: 23,632,680 A110V probably benign Het
Vmn2r31 G T 7: 7,384,608 Q655K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,323,603 probably benign Het
Zc3h13 CG CGAGATGTGTG 14: 75,323,610 probably benign Het
Zfp282 GGC GGCCGC 6: 47,904,797 probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,036,493 probably benign Het
Zfp459 TGA TGAGCGA 13: 67,408,274 probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp831 CCT CCTGCT 2: 174,645,481 probably benign Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
R7353:Cttnbp2 UTSW 6 18375944 missense possibly damaging 0.94
R7465:Cttnbp2 UTSW 6 18501992 missense probably damaging 1.00
R7500:Cttnbp2 UTSW 6 18378420 missense probably benign 0.00
R7534:Cttnbp2 UTSW 6 18420765 critical splice donor site probably null
R7646:Cttnbp2 UTSW 6 18375940 missense probably damaging 1.00
R7678:Cttnbp2 UTSW 6 18382810 missense probably damaging 1.00
R7809:Cttnbp2 UTSW 6 18434290 missense probably damaging 0.99
R7816:Cttnbp2 UTSW 6 18448414 missense probably damaging 1.00
R7817:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8010:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8011:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8014:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8015:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
Z1176:Cttnbp2 UTSW 6 18408709 missense probably benign 0.00
Z1176:Cttnbp2 UTSW 6 18408725 missense possibly damaging 0.94
Z1176:Cttnbp2 UTSW 6 18420836 missense possibly damaging 0.83
Z1176:Cttnbp2 UTSW 6 18501960 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05