Incidental Mutation 'FR4304:Cd22'
ID 511003
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb8, Lyb-8
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4304 ()
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30564829-30579767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30577507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 2 (R2H)
Ref Sequence ENSEMBL: ENSMUSP00000140528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000190753] [ENSMUST00000187989] [ENSMUST00000190646] [ENSMUST00000190617] [ENSMUST00000188157] [ENSMUST00000189718] [ENSMUST00000214289]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000019248
AA Change: R2H

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108125
AA Change: R2H

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186154
AA Change: R2H

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187436
Predicted Effect unknown
Transcript: ENSMUST00000190753
AA Change: R2H
Predicted Effect unknown
Transcript: ENSMUST00000187989
AA Change: R2H
Predicted Effect possibly damaging
Transcript: ENSMUST00000190646
AA Change: R2H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190617
AA Change: R2H

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188157
AA Change: R2H

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140450
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189718
AA Change: R2H

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: R2H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187585
Predicted Effect unknown
Transcript: ENSMUST00000214289
AA Change: R2H
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Homo
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
4930447C04Rik AAGT A 12: 72,928,061 (GRCm39) probably benign Homo
Acbd4 CAG CAGACTAG 11: 102,994,931 (GRCm39) probably null Homo
Ahdc1 CT CTCTT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTGCT 7: 80,727,510 (GRCm39) probably benign Het
Anapc4 C T 5: 53,021,868 (GRCm39) T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,591,163 (GRCm39) probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,415,050 (GRCm39) probably benign Het
Apol6 TTGT TTGTCTGT 15: 76,935,636 (GRCm39) probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,232,736 (GRCm39) probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,063,601 (GRCm39) probably null Het
Blm CT CTACGT 7: 80,113,521 (GRCm39) probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,162,667 (GRCm39) probably benign Het
Btnl10 GA GAATA 11: 58,814,756 (GRCm39) probably benign Homo
Cacna1f AGG AGGCGG X: 7,486,300 (GRCm39) probably benign Het
Calhm3 CG CGG 19: 47,140,335 (GRCm39) probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,228,023 (GRCm39) probably null Homo
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Ccdc15 AC ACTTTCC 9: 37,226,453 (GRCm39) probably null Het
Ccdc162 T C 10: 41,432,117 (GRCm39) D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,511,021 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,240,871 (GRCm39) probably benign Het
Cd80 AGA AGAGGA 16: 38,306,677 (GRCm39) probably benign Homo
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap74 A G 4: 155,500,217 (GRCm39) D21G possibly damaging Homo
Cgref1 T TCTA 5: 31,091,124 (GRCm39) probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,099,107 (GRCm39) probably benign Het
Cnpy3 TCC TCCCCC 17: 47,047,669 (GRCm39) probably benign Het
Cnpy3 TCC TCCACC 17: 47,047,672 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,080,415 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,457 (GRCm39) probably benign Het
Dhx37 CTGG C 5: 125,504,594 (GRCm39) probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 TCC TCCCCC 2: 130,612,668 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dst C A 1: 34,240,045 (GRCm39) S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,763,728 (GRCm39) probably benign Homo
Ermn TTC TTCCTC 2: 57,938,090 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,098 (GRCm39) probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,243 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,240 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,031,933 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gm5114 T C 7: 39,060,529 (GRCm39) R107G probably benign Het
Gm5114 A C 7: 39,060,530 (GRCm39) H106Q probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,431,173 (GRCm39) probably null Het
Ifi203 C T 1: 173,755,894 (GRCm39) probably benign Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Il17rd CGG CGGTGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,179,975 (GRCm39) probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,013 (GRCm39) probably benign Het
Ipo9 CCT CCTACT 1: 135,314,017 (GRCm39) probably null Het
Isg20l2 AAG AAGCAG 3: 87,839,019 (GRCm39) probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,520,764 (GRCm39) probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,280,100 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,426 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,427 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lrch1 A T 14: 75,057,005 (GRCm39) C241S possibly damaging Het
Lrit3 G GCTT 3: 129,582,468 (GRCm39) probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,532,755 (GRCm39) probably benign Homo
Mast4 T TTTC 13: 102,871,370 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Muc21 T G 17: 35,933,013 (GRCm39) probably benign Homo
Noc2l TGC TGCAGC 4: 156,324,553 (GRCm39) probably benign Het
Nrg3 G GACATTT 14: 38,119,230 (GRCm39) probably benign Homo
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Homo
Patl2 GCT GCTTCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,006,685 (GRCm39) probably null Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,468,290 (GRCm39) probably benign Het
Prkd3 G T 17: 79,283,249 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Het
Prr13 TCC TCCCCC 15: 102,370,612 (GRCm39) probably benign Homo
Prrc2b G A 2: 32,111,179 (GRCm39) A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,891,421 (GRCm39) probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,557,632 (GRCm39) probably benign Homo
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Sry GTG GTGCTG Y: 2,662,837 (GRCm39) probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 98,110,111 (GRCm39) probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,635,085 (GRCm39) probably null Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Sytl1 CTCT C 4: 132,984,304 (GRCm39) probably benign Homo
Tcof1 AGC AGCGGC 18: 60,968,814 (GRCm39) probably benign Het
Tdpoz2 T TCA 3: 93,558,922 (GRCm39) probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,796,421 (GRCm39) probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Ticrr ATT ATTTTT 7: 79,344,059 (GRCm39) probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tnfrsf9 T TGCC 4: 151,018,852 (GRCm39) probably benign Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CA CAGTA 11: 94,105,303 (GRCm39) probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,877,587 (GRCm39) probably benign Homo
Tsbp1 A AGCC 17: 34,679,029 (GRCm39) probably benign Het
Tsbp1 GC GCATC 17: 34,679,051 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,197,784 (GRCm39) probably benign Het
Vars1 TGG TGGAGTCCTGGGCGG 17: 35,234,965 (GRCm39) probably benign Homo
Vmn1r171 C T 7: 23,332,105 (GRCm39) A110V probably benign Het
Vmn2r31 G T 7: 7,387,607 (GRCm39) Q655K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 CG CGAGATGTGTG 14: 75,561,050 (GRCm39) probably benign Het
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,561,043 (GRCm39) probably benign Het
Zfp282 GGC GGCCGC 6: 47,881,731 (GRCm39) probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,013,456 (GRCm39) probably benign Het
Zfp459 TGA TGAGCGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp831 CCT CCTGCT 2: 174,487,274 (GRCm39) probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30,575,572 (GRCm39) missense probably benign 0.01
IGL02236:Cd22 APN 7 30,566,893 (GRCm39) missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30,569,308 (GRCm39) missense probably damaging 1.00
IGL02335:Cd22 APN 7 30,575,559 (GRCm39) missense probably damaging 1.00
IGL02397:Cd22 APN 7 30,577,050 (GRCm39) missense probably benign
IGL02402:Cd22 APN 7 30,576,955 (GRCm39) missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30,576,985 (GRCm39) missense probably benign 0.40
IGL02736:Cd22 APN 7 30,577,470 (GRCm39) splice site probably null
blitz UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
crullers UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
gansu UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
lacrima UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
Lluvia UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
Mist UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
rain UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
well UTSW 7 30,577,212 (GRCm39) nonsense probably null
Yosemite UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
FR4340:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30,577,224 (GRCm39) missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30,566,533 (GRCm39) splice site probably benign
R0130:Cd22 UTSW 7 30,569,389 (GRCm39) missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
R1245:Cd22 UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
R1332:Cd22 UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30,572,595 (GRCm39) missense probably benign 0.07
R1716:Cd22 UTSW 7 30,577,103 (GRCm39) missense probably damaging 1.00
R1980:Cd22 UTSW 7 30,572,658 (GRCm39) missense probably damaging 1.00
R2017:Cd22 UTSW 7 30,572,205 (GRCm39) missense probably damaging 0.99
R2061:Cd22 UTSW 7 30,575,581 (GRCm39) missense probably benign 0.03
R2061:Cd22 UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
R2075:Cd22 UTSW 7 30,569,123 (GRCm39) missense probably damaging 1.00
R2216:Cd22 UTSW 7 30,566,471 (GRCm39) missense probably damaging 1.00
R3886:Cd22 UTSW 7 30,569,532 (GRCm39) missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30,575,325 (GRCm39) missense probably damaging 0.98
R4701:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R4796:Cd22 UTSW 7 30,572,381 (GRCm39) splice site probably null
R5179:Cd22 UTSW 7 30,575,299 (GRCm39) missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
R5456:Cd22 UTSW 7 30,575,464 (GRCm39) missense probably benign 0.02
R5511:Cd22 UTSW 7 30,569,496 (GRCm39) missense probably damaging 1.00
R5513:Cd22 UTSW 7 30,566,450 (GRCm39) missense probably damaging 0.99
R5611:Cd22 UTSW 7 30,577,575 (GRCm39) unclassified probably benign
R5656:Cd22 UTSW 7 30,569,198 (GRCm39) missense probably damaging 1.00
R5966:Cd22 UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
R6329:Cd22 UTSW 7 30,577,193 (GRCm39) missense probably damaging 0.99
R6356:Cd22 UTSW 7 30,577,127 (GRCm39) missense probably damaging 1.00
R6455:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R6550:Cd22 UTSW 7 30,576,977 (GRCm39) missense probably benign 0.00
R6656:Cd22 UTSW 7 30,577,182 (GRCm39) missense probably benign 0.11
R6688:Cd22 UTSW 7 30,572,389 (GRCm39) missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30,572,856 (GRCm39) splice site probably null
R6957:Cd22 UTSW 7 30,566,999 (GRCm39) missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30,577,504 (GRCm39) missense probably benign 0.03
R7083:Cd22 UTSW 7 30,567,473 (GRCm39) missense probably damaging 0.99
R7225:Cd22 UTSW 7 30,577,059 (GRCm39) missense not run
R7732:Cd22 UTSW 7 30,569,482 (GRCm39) missense probably damaging 1.00
R8686:Cd22 UTSW 7 30,569,494 (GRCm39) missense probably benign 0.03
R8851:Cd22 UTSW 7 30,577,084 (GRCm39) missense probably benign 0.01
R8987:Cd22 UTSW 7 30,577,172 (GRCm39) missense probably damaging 1.00
R9051:Cd22 UTSW 7 30,575,449 (GRCm39) missense probably benign
R9098:Cd22 UTSW 7 30,567,391 (GRCm39) missense probably benign 0.00
R9124:Cd22 UTSW 7 30,572,662 (GRCm39) missense probably benign 0.01
R9167:Cd22 UTSW 7 30,575,430 (GRCm39) missense probably benign 0.07
R9319:Cd22 UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
R9369:Cd22 UTSW 7 30,576,999 (GRCm39) missense probably benign 0.09
X0025:Cd22 UTSW 7 30,572,844 (GRCm39) splice site probably null
Z1176:Cd22 UTSW 7 30,568,955 (GRCm39) missense probably damaging 1.00
Z1176:Cd22 UTSW 7 30,567,388 (GRCm39) missense probably benign 0.03
Z1186:Cd22 UTSW 7 30,566,891 (GRCm39) missense probably benign
Z1186:Cd22 UTSW 7 30,566,478 (GRCm39) missense probably benign 0.01
Z1186:Cd22 UTSW 7 30,575,292 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGAGGGGTGAGAACTTCC -3'
(R):5'- CAACAAGATGGCTCAAAGGC -3'

Sequencing Primer
(F):5'- GGGTGAGAACTTCCACTGG -3'
(R):5'- AAGGCAAATTCCTTTTGTTGTTCTTG -3'
Posted On 2018-04-05