Incidental Mutation 'FR4304:Zc3h13'
ID 511048
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Name zinc finger CCCH type containing 13
Synonyms 3110050K21Rik, C87618, 4930570G11Rik, 2600010B19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # FR4304 ()
Quality Score 217.475
Status Not validated
Chromosome 14
Chromosomal Location 75521813-75581866 bp(+) (GRCm39)
Type of Mutation small insertion (3 aa in frame mutation)
DNA Base Change (assembly) AGATGTGCG to AGATGTGCGGGATGTGCG at 75561043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold E9Q784
Predicted Effect probably benign
Transcript: ENSMUST00000022577
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226417
Predicted Effect probably benign
Transcript: ENSMUST00000227049
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 136 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Homo
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
4930447C04Rik AAGT A 12: 72,928,061 (GRCm39) probably benign Homo
Acbd4 CAG CAGACTAG 11: 102,994,931 (GRCm39) probably null Homo
Ahdc1 CT CTCTT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTGCT 7: 80,727,510 (GRCm39) probably benign Het
Anapc4 C T 5: 53,021,868 (GRCm39) T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,591,163 (GRCm39) probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,415,050 (GRCm39) probably benign Het
Apol6 TTGT TTGTCTGT 15: 76,935,636 (GRCm39) probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,232,736 (GRCm39) probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,063,601 (GRCm39) probably null Het
Blm CT CTACGT 7: 80,113,521 (GRCm39) probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,162,667 (GRCm39) probably benign Het
Btnl10 GA GAATA 11: 58,814,756 (GRCm39) probably benign Homo
Cacna1f AGG AGGCGG X: 7,486,300 (GRCm39) probably benign Het
Calhm3 CG CGG 19: 47,140,335 (GRCm39) probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,228,023 (GRCm39) probably null Homo
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Ccdc15 AC ACTTTCC 9: 37,226,453 (GRCm39) probably null Het
Ccdc162 T C 10: 41,432,117 (GRCm39) D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,511,021 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,240,871 (GRCm39) probably benign Het
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,306,677 (GRCm39) probably benign Homo
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap74 A G 4: 155,500,217 (GRCm39) D21G possibly damaging Homo
Cgref1 T TCTA 5: 31,091,124 (GRCm39) probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,099,107 (GRCm39) probably benign Het
Cnpy3 TCC TCCACC 17: 47,047,672 (GRCm39) probably benign Het
Cnpy3 TCC TCCCCC 17: 47,047,669 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,080,415 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,457 (GRCm39) probably benign Het
Dhx37 CTGG C 5: 125,504,594 (GRCm39) probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 TCC TCCCCC 2: 130,612,668 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dst C A 1: 34,240,045 (GRCm39) S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,763,728 (GRCm39) probably benign Homo
Ermn TTC TTCCTC 2: 57,938,090 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,098 (GRCm39) probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,243 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,240 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,031,933 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gm5114 T C 7: 39,060,529 (GRCm39) R107G probably benign Het
Gm5114 A C 7: 39,060,530 (GRCm39) H106Q probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,431,173 (GRCm39) probably null Het
Ifi203 C T 1: 173,755,894 (GRCm39) probably benign Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Il17rd CGG CGGTGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,179,975 (GRCm39) probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,013 (GRCm39) probably benign Het
Ipo9 CCT CCTACT 1: 135,314,017 (GRCm39) probably null Het
Isg20l2 AAG AAGCAG 3: 87,839,019 (GRCm39) probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,520,764 (GRCm39) probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,280,100 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,426 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,427 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lrch1 A T 14: 75,057,005 (GRCm39) C241S possibly damaging Het
Lrit3 G GCTT 3: 129,582,468 (GRCm39) probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,532,755 (GRCm39) probably benign Homo
Mast4 T TTTC 13: 102,871,370 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Muc21 T G 17: 35,933,013 (GRCm39) probably benign Homo
Noc2l TGC TGCAGC 4: 156,324,553 (GRCm39) probably benign Het
Nrg3 G GACATTT 14: 38,119,230 (GRCm39) probably benign Homo
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Homo
Patl2 GCT GCTTCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,006,685 (GRCm39) probably null Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,468,290 (GRCm39) probably benign Het
Prkd3 G T 17: 79,283,249 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Het
Prr13 TCC TCCCCC 15: 102,370,612 (GRCm39) probably benign Homo
Prrc2b G A 2: 32,111,179 (GRCm39) A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,891,421 (GRCm39) probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,557,632 (GRCm39) probably benign Homo
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Sry GTG GTGCTG Y: 2,662,837 (GRCm39) probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 98,110,111 (GRCm39) probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,635,085 (GRCm39) probably null Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Sytl1 CTCT C 4: 132,984,304 (GRCm39) probably benign Homo
Tcof1 AGC AGCGGC 18: 60,968,814 (GRCm39) probably benign Het
Tdpoz2 T TCA 3: 93,558,922 (GRCm39) probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,796,421 (GRCm39) probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Ticrr ATT ATTTTT 7: 79,344,059 (GRCm39) probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tnfrsf9 T TGCC 4: 151,018,852 (GRCm39) probably benign Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CA CAGTA 11: 94,105,303 (GRCm39) probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,877,587 (GRCm39) probably benign Homo
Tsbp1 A AGCC 17: 34,679,029 (GRCm39) probably benign Het
Tsbp1 GC GCATC 17: 34,679,051 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,197,784 (GRCm39) probably benign Het
Vars1 TGG TGGAGTCCTGGGCGG 17: 35,234,965 (GRCm39) probably benign Homo
Vmn1r171 C T 7: 23,332,105 (GRCm39) A110V probably benign Het
Vmn2r31 G T 7: 7,387,607 (GRCm39) Q655K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zfp282 GGC GGCCGC 6: 47,881,731 (GRCm39) probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,013,456 (GRCm39) probably benign Het
Zfp459 TGA TGAGCGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp831 CCT CCTGCT 2: 174,487,274 (GRCm39) probably benign Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75,567,587 (GRCm39) missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75,573,439 (GRCm39) missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75,547,163 (GRCm39) missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75,581,209 (GRCm39) utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75,567,787 (GRCm39) missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75,569,206 (GRCm39) missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75,531,381 (GRCm39) missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75,531,416 (GRCm39) missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75,553,479 (GRCm39) missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75,561,050 (GRCm39) small insertion probably benign
FR4340:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4449:Zc3h13 UTSW 14 75,561,041 (GRCm39) nonsense probably null
FR4548:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,038 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,037 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,036 (GRCm39) small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75,569,323 (GRCm39) missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75,560,694 (GRCm39) missense unknown
R0374:Zc3h13 UTSW 14 75,546,405 (GRCm39) missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75,560,922 (GRCm39) missense unknown
R0408:Zc3h13 UTSW 14 75,529,626 (GRCm39) nonsense probably null
R0967:Zc3h13 UTSW 14 75,581,179 (GRCm39) missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75,553,424 (GRCm39) missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75,574,923 (GRCm39) nonsense probably null
R2021:Zc3h13 UTSW 14 75,567,635 (GRCm39) missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75,569,587 (GRCm39) missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75,546,380 (GRCm39) nonsense probably null
R3745:Zc3h13 UTSW 14 75,568,101 (GRCm39) missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75,567,178 (GRCm39) missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75,565,041 (GRCm39) missense unknown
R4799:Zc3h13 UTSW 14 75,576,863 (GRCm39) missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75,576,836 (GRCm39) missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75,573,449 (GRCm39) missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75,581,059 (GRCm39) missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75,568,687 (GRCm39) missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75,568,348 (GRCm39) missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75,569,400 (GRCm39) nonsense probably null
R5726:Zc3h13 UTSW 14 75,568,269 (GRCm39) missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75,565,572 (GRCm39) missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75,568,149 (GRCm39) missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75,574,849 (GRCm39) missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75,581,176 (GRCm39) missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75,567,863 (GRCm39) missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75,546,355 (GRCm39) missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75,560,998 (GRCm39) small deletion probably benign
R6598:Zc3h13 UTSW 14 75,569,623 (GRCm39) missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75,568,597 (GRCm39) missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75,559,227 (GRCm39) missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75,559,161 (GRCm39) missense unknown
R7307:Zc3h13 UTSW 14 75,567,981 (GRCm39) missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75,546,349 (GRCm39) missense unknown
R7680:Zc3h13 UTSW 14 75,567,955 (GRCm39) missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75,568,070 (GRCm39) missense not run
R8048:Zc3h13 UTSW 14 75,561,977 (GRCm39) missense unknown
R8059:Zc3h13 UTSW 14 75,565,250 (GRCm39) missense unknown
R8362:Zc3h13 UTSW 14 75,561,909 (GRCm39) missense unknown
R8391:Zc3h13 UTSW 14 75,568,625 (GRCm39) missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75,569,512 (GRCm39) missense probably benign 0.05
R9081:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9082:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9101:Zc3h13 UTSW 14 75,561,042 (GRCm39) missense unknown
R9214:Zc3h13 UTSW 14 75,560,991 (GRCm39) missense unknown
R9308:Zc3h13 UTSW 14 75,565,418 (GRCm39) missense unknown
R9376:Zc3h13 UTSW 14 75,561,128 (GRCm39) missense unknown
R9618:Zc3h13 UTSW 14 75,567,542 (GRCm39) missense
R9665:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
Z1177:Zc3h13 UTSW 14 75,565,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGACTCCAGAGACATGCG -3'
(R):5'- AGAACTCTCTTCTCTCAGGTGG -3'

Sequencing Primer
(F):5'- TCCAGAGACATGCGGGACTC -3'
(R):5'- CAGGTGGTTTCTGCCATAACTGC -3'
Posted On 2018-04-05