Incidental Mutation 'FR4304:Cacna1f'
List |< first << previous [record 99 of 1113] next >> last >|
ID511080
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #FR4304 ()
Quality Score106.467
Status Not validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGG to AGGCGG at 7620061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably benign
Transcript: ENSMUST00000115725
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115726
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133637
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144522
Predicted Effect probably benign
Transcript: ENSMUST00000155090
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Homo
4930402H24Rik TCC TCCCCC 2: 130,770,748 probably benign Het
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4930447C04Rik AAGT A 12: 72,881,287 probably benign Homo
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
Acbd4 CAG CAGACTAG 11: 103,104,105 probably null Homo
Ahdc1 CT CTCTT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTGCT 7: 81,077,762 probably benign Het
Anapc4 C T 5: 52,864,526 T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,924 probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,683,847 probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,281,997 probably benign Het
Apol6 TTGT TTGTCTGT 15: 77,051,436 probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,405,168 probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,126,791 probably null Het
BC051142 A AGCC 17: 34,460,055 probably benign Het
BC051142 GC GCATC 17: 34,460,077 probably benign Het
Blm CT CTACGT 7: 80,463,773 probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,512,919 probably benign Het
Btnl10 GA GAATA 11: 58,923,930 probably benign Homo
Calhm3 CG CGG 19: 47,151,896 probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,397,542 probably null Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Ccdc15 AC ACTTTCC 9: 37,315,157 probably null Het
Ccdc162 T C 10: 41,556,121 D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,561,021 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,274,612 probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,486,315 probably benign Homo
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap74 A G 4: 155,415,760 D21G possibly damaging Homo
Cgref1 T TCTA 5: 30,933,780 probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,122,144 probably benign Het
Cnpy3 TCC TCCCCC 17: 46,736,743 probably benign Het
Cnpy3 TCC TCCACC 17: 46,736,746 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,189,589 probably benign Het
Col2a1 C A 15: 97,988,981 silent Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,458 probably benign Het
Dhx37 CTGG C 5: 125,427,530 probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dst C A 1: 34,200,964 S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,775,290 probably benign Homo
Ermn TTC TTCCTC 2: 58,048,078 probably benign Het
Ermn CTT CTTGTT 2: 58,048,086 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,094 probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,097 probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,100 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,196,072 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm5114 T C 7: 39,411,105 R107G probably benign Het
Gm5114 A C 7: 39,411,106 H106Q probably benign Het
Gm9573 T G 17: 35,622,121 E391A probably benign Homo
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,120,281 probably null Het
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Ifi203 C T 1: 173,928,328 A630T probably benign Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Il17rd CGG CGGTGG 14: 27,082,680 probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,125,826 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTACT 1: 135,386,279 probably null Het
Isg20l2 AAG AAGCAG 3: 87,931,712 probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,315,766 probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,389,274 probably benign Het
Las1l GAG GAGCAG X: 95,940,820 probably benign Het
Las1l AGG AGGCGG X: 95,940,821 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lrch1 A T 14: 74,819,565 C241S possibly damaging Het
Lrit3 G GCTT 3: 129,788,819 probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,621,459 probably benign Homo
Mast4 T TTTC 13: 102,734,862 probably benign Het
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Noc2l TGC TGCAGC 4: 156,240,096 probably benign Het
Nrg3 G GACATTT 14: 38,397,273 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Het
Patl2 GCT GCTTCT 2: 122,126,135 probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Homo
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,479,858 probably benign Het
Prkd3 G T 17: 78,975,820 probably benign Homo
Prr13 TCC TCCCCC 15: 102,462,177 probably benign Homo
Prrc2b G A 2: 32,221,167 A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,914,458 probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,591,198 probably benign Homo
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Sry GTG GTGCTG Y: 2,662,837 probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 99,066,505 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,727,664 probably null Het
Sytl1 CTCT C 4: 133,256,993 probably benign Homo
Tcof1 AGC AGCGGC 18: 60,835,742 probably benign Het
Tdpoz2 T TCA 3: 93,651,615 probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,648,302 probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Ticrr ATT ATTTTT 7: 79,694,311 probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tnfrsf9 T TGCC 4: 150,934,395 probably benign Homo
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 CA CAGTA 11: 94,214,477 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,993,387 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,306,958 probably benign Het
Vars TGG TGGAGTCCTGGGCGG 17: 35,015,989 probably benign Homo
Vmn1r171 C T 7: 23,632,680 A110V probably benign Het
Vmn2r31 G T 7: 7,384,608 Q655K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,323,603 probably benign Het
Zc3h13 CG CGAGATGTGTG 14: 75,323,610 probably benign Het
Zfp282 GGC GGCCGC 6: 47,904,797 probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,036,493 probably benign Het
Zfp459 TGA TGAGCGA 13: 67,408,274 probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp831 CCT CCTGCT 2: 174,645,481 probably benign Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 unclassified probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 unclassified probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 unclassified probably benign
IGL02167:Cacna1f APN X 7616019 unclassified probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 unclassified probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 unclassified probably benign
IGL03006:Cacna1f APN X 7626903 unclassified probably damaging 1.00
FR4340:Cacna1f UTSW X 7620067 small insertion probably benign
FR4548:Cacna1f UTSW X 7620058 small insertion probably benign
R0629:Cacna1f UTSW X 7620434 missense probably damaging 0.99
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 splice site probably benign
R2508:Cacna1f UTSW X 7626448 splice site probably benign
R4195:Cacna1f UTSW X 7608930 missense probably damaging 1.00
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R4366:Cacna1f UTSW X 7609974 missense probably damaging 1.00
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCATATAACACTCACTAGG -3'
(R):5'- TACTGGCATTCCCAACACTC -3'

Sequencing Primer
(F):5'- TGTCCCAGCGCTGTTCTAAGAG -3'
(R):5'- CCAACACTCACGGGTTGGTTTG -3'
Posted OnApr 05, 2018