Incidental Mutation 'FR4340:Mast4'
ID511169
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #FR4340 ()
Quality Score164.468
Status Not validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTTT to TTTTATTT at 102734857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect probably benign
Transcript: ENSMUST00000099202
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167058
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171791
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect probably benign
Transcript: ENSMUST00000194446
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
4930578G10Rik G T 4: 42,761,098 probably benign Het
4932438A13Rik TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,050,752 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530032D15Rik A C 1: 85,109,351 N6K probably damaging Het
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Arpc1b CC CCTGGTC 5: 145,126,792 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
BC051142 CAG CAGTAG 17: 34,460,060 probably null Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
BC051142 GC GCAAC 17: 34,460,077 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,463,767 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,910 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Cacna1f AGG AGGCGG X: 7,620,067 probably benign Het
Calhm1 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG 19: 47,141,251 probably benign Het
Casz1 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC 4: 148,952,302 probably benign Homo
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,486,316 probably benign Homo
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Crygc A T 1: 65,071,663 F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cyp2d11 T TGGGA 15: 82,390,022 probably null Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dnah8 ACACTGCC AC 17: 30,635,463 probably benign Het
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fam45a CT CTTTT 19: 60,814,621 probably benign Homo
Frem3 CT CTTTT 8: 80,615,241 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,577,152 probably benign Het
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gm16519 A AGAAC 17: 70,929,338 probably null Homo
Gm4340 CAG CAGTAG 10: 104,196,075 probably null Het
Gm4340 GCAG GCAACAG 10: 104,196,098 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 78,842,174 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,386,269 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,712 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CAC CACGAC 11: 99,386,202 probably benign Het
Krt10 ACCG ACCGCCG 11: 99,386,203 probably benign Homo
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,389,274 probably benign Het
Las1l TCCTC TCCTCTACCTC X: 95,940,622 probably benign Het
Lce1a1 C T 3: 92,646,844 G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,697,594 probably benign Het
Lrit3 CTG CTGTTG 3: 129,788,808 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,846 probably benign Het
Mapk7 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG 11: 61,490,206 probably benign Het
Med12l AGC AGCCGC 3: 59,275,985 probably benign Het
Mfsd5 G A 15: 102,281,161 V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,599,761 probably benign Het
Naip1 A C 13: 100,423,076 M1140R probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Homo
Nefh ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG 11: 4,941,033 probably benign Het
Nefh GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,038 probably benign Homo
Nefh CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,040 probably benign Homo
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nutf2 G T 8: 105,876,570 D78Y probably damaging Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr513 AT ATGATATT 7: 108,754,954 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pdik1l ACCAC ACCACCCCCAC 4: 134,279,512 probably benign Het
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Prag1 C CAGT 8: 36,103,886 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,265,164 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Six3 CGG CGGGGG 17: 85,621,356 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Tbr1 A C 2: 61,806,347 probably benign Het
Tdpoz2 T TCC 3: 93,651,615 probably null Homo
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,616,351 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tob1 AGC AGCCGC 11: 94,214,454 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,460 probably benign Het
Tob1 CA CAGAA 11: 94,214,477 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Triobp TCGG TCGGCGG 15: 78,993,390 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,066 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Homo
Ubtf TCC TCCCCC 11: 102,306,950 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp384 AAGCCCAGGCCCAGGCCCAGGCCCA AAGCCCAGGCCCAAGCCCAGGCCCAGGCCCAGGCCCA 6: 125,036,463 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,480 probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,825,729 probably null Homo
Zfp936 G A 7: 43,189,489 G127R possibly damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTCGGTCAGCAAGGTG -3'
(R):5'- GAAAGACTTCGTGGTTCGGC -3'

Sequencing Primer
(F):5'- TCAGCAAGGTGGTCAGCTG -3'
(R):5'- ACTTCGTGGTTCGGCAGAGAAG -3'
Posted On2018-04-05