Incidental Mutation 'FR4340:Dnah12'
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #FR4340 ()
Quality Score221.999
Status Not validated
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26849385 bp
Amino Acid Change Glycine to Valine at position 2817 (G2817V)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: G2817V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: G2817V

low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165269
AA Change: G197V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130609
Gene: ENSMUSG00000021879
AA Change: G197V

Pfam:MT 1 248 5.7e-40 PFAM
Pfam:AAA_9 270 495 3.8e-96 PFAM
low complexity region 593 606 N/A INTRINSIC
Pfam:Dynein_heavy 631 1336 2e-287 PFAM
Meta Mutation Damage Score 0.2993 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
4930578G10Rik G T 4: 42,761,098 probably benign Het
4932438A13Rik TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,050,752 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530032D15Rik A C 1: 85,109,351 N6K probably damaging Het
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Arpc1b CC CCTGGTC 5: 145,126,792 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
BC051142 CAG CAGTAG 17: 34,460,060 probably null Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
BC051142 GC GCAAC 17: 34,460,077 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,463,767 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Cacna1f AGG AGGCGG X: 7,620,067 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,486,316 probably benign Homo
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Crygc A T 1: 65,071,663 F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cyp2d11 T TGGGA 15: 82,390,022 probably null Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dnah8 ACACTGCC AC 17: 30,635,463 probably benign Het
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fam45a CT CTTTT 19: 60,814,621 probably benign Homo
Frem3 CT CTTTT 8: 80,615,241 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,577,152 probably benign Het
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gm16519 A AGAAC 17: 70,929,338 probably null Homo
Gm4340 CAG CAGTAG 10: 104,196,075 probably null Het
Gm4340 GCAG GCAACAG 10: 104,196,098 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 78,842,174 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,386,269 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,712 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CAC CACGAC 11: 99,386,202 probably benign Het
Krt10 ACCG ACCGCCG 11: 99,386,203 probably benign Homo
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,389,274 probably benign Het
Las1l TCCTC TCCTCTACCTC X: 95,940,622 probably benign Het
Lce1a1 C T 3: 92,646,844 G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,697,594 probably benign Het
Lrit3 CTG CTGTTG 3: 129,788,808 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,846 probably benign Het
Mast4 TTTT TTTTATTT 13: 102,734,857 probably null Het
Mast4 GCA GCAGTGTCA 13: 102,736,317 probably benign Homo
Med12l AGC AGCCGC 3: 59,275,985 probably benign Het
Mfsd5 G A 15: 102,281,161 V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,599,761 probably benign Het
Naip1 A C 13: 100,423,076 M1140R probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Homo
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nutf2 G T 8: 105,876,570 D78Y probably damaging Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr513 AT ATGATATT 7: 108,754,954 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pdik1l ACCAC ACCACCCCCAC 4: 134,279,512 probably benign Het
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Prag1 C CAGT 8: 36,103,886 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,265,164 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Six3 CGG CGGGGG 17: 85,621,356 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 probably benign Het
Tbr1 A C 2: 61,806,347 probably benign Het
Tdpoz2 T TCC 3: 93,651,615 probably null Homo
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,616,351 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tob1 AGC AGCCGC 11: 94,214,454 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,460 probably benign Het
Tob1 CA CAGAA 11: 94,214,477 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Triobp TCGG TCGGCGG 15: 78,993,390 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,066 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Homo
Ubtf TCC TCCCCC 11: 102,306,950 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,480 probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,825,729 probably null Homo
Zfp936 G A 7: 43,189,489 G127R possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26766115 missense probably benign 0.00
BB020:Dnah12 UTSW 14 26766115 missense probably benign 0.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 splice site probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 splice site probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26796219 missense probably benign 0.01
R7855:Dnah12 UTSW 14 26829329 missense probably benign 0.14
R7870:Dnah12 UTSW 14 26856529 missense probably benign 0.00
R7920:Dnah12 UTSW 14 26856542 missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26766115 missense probably benign 0.00
R7956:Dnah12 UTSW 14 26709272 missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26706881 missense probably benign
R8263:Dnah12 UTSW 14 26891464 missense noncoding transcript
R8287:Dnah12 UTSW 14 26812603 missense probably benign
R8336:Dnah12 UTSW 14 26711065 missense probably benign 0.01
R8362:Dnah12 UTSW 14 26854831 missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26885912 missense probably benign
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26875215 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05