Incidental Mutation 'FR4340:Triobp'
ID 511174
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # FR4340 ()
Quality Score 214.459
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) TCGG to TCGGCGG at 78877590 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109687
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
4930578G10Rik G T 4: 42,761,098 (GRCm39) probably benign Het
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,470,549 (GRCm39) probably benign Homo
Arpc1b CC CCTGGTC 5: 145,063,602 (GRCm39) probably null Het
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,113,515 (GRCm39) probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,658 (GRCm39) probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bltp1 TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,104,901 (GRCm39) probably benign Het
Cacna1a ACC ACCGCC 8: 85,365,352 (GRCm39) probably benign Het
Cacna1f AGG AGGCGG X: 7,486,306 (GRCm39) probably benign Het
Calhm1 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG 19: 47,129,690 (GRCm39) probably benign Het
Casz1 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC 4: 149,036,759 (GRCm39) probably benign Homo
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Het
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Het
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,306,678 (GRCm39) probably benign Homo
Cimip2b CAGAG CAG 4: 43,427,384 (GRCm39) probably null Homo
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Crygc A T 1: 65,110,822 (GRCm39) F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cyp2d11 T TGGGA 15: 82,274,223 (GRCm39) probably null Homo
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dennd10 CT CTTTT 19: 60,803,059 (GRCm39) probably benign Homo
Dennd2b CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,156,128 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dnah8 ACACTGCC AC 17: 30,854,437 (GRCm39) probably benign Het
Dthd1 C CTTA 5: 63,000,369 (GRCm39) probably benign Homo
Frem3 CT CTTTT 8: 81,341,870 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,504,873 (GRCm39) probably benign Het
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm14393 T C 2: 174,903,427 (GRCm39) E160G possibly damaging Het
Gm16519 A AGAAC 17: 71,236,333 (GRCm39) probably null Homo
Gm4340 GCAG GCAACAG 10: 104,031,959 (GRCm39) probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,031,960 (GRCm39) probably benign Het
Gm4340 CAG CAGTAG 10: 104,031,936 (GRCm39) probably null Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 79,149,603 (GRCm39) probably benign Het
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,314,007 (GRCm39) probably benign Het
Ipo9 CTC CTCTTC 1: 135,314,009 (GRCm39) probably benign Het
Isg20l2 AAG AAGTAG 3: 87,839,019 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,800 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,794 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,280,100 (GRCm39) probably benign Het
Krt10 CAC CACGAC 11: 99,277,028 (GRCm39) probably benign Het
Krt10 ACCG ACCGCCG 11: 99,277,029 (GRCm39) probably benign Homo
Las1l TCCTC TCCTCTACCTC X: 94,984,228 (GRCm39) probably benign Het
Lce1a1 C T 3: 92,554,151 (GRCm39) G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,339,387 (GRCm39) probably benign Het
Lrit3 CTG CTGTTG 3: 129,582,457 (GRCm39) probably benign Het
Mamld1 CAG CAGAAG X: 70,162,452 (GRCm39) probably benign Het
Mapk7 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG 11: 61,381,032 (GRCm39) probably benign Het
Mast4 GCA GCAGTGTCA 13: 102,872,825 (GRCm39) probably benign Homo
Mast4 TTTT TTTTATTT 13: 102,871,365 (GRCm39) probably null Het
Med12l AGC AGCCGC 3: 59,183,406 (GRCm39) probably benign Het
Mfsd5 G A 15: 102,189,596 (GRCm39) V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,549,761 (GRCm39) probably benign Het
Naip1 A C 13: 100,559,584 (GRCm39) M1140R probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Homo
Nefh CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,040 (GRCm39) probably benign Homo
Nefh ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG 11: 4,891,033 (GRCm39) probably benign Het
Nefh GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,038 (GRCm39) probably benign Homo
Neu1 TCTTCTA T 17: 35,151,534 (GRCm39) probably benign Het
Nutf2 G T 8: 106,603,202 (GRCm39) D78Y probably damaging Het
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Or5e1 AT ATGATATT 7: 108,354,161 (GRCm39) probably benign Homo
Or5p70 A G 7: 107,995,100 (GRCm39) T258A probably benign Het
Or5p70 G A 7: 107,995,105 (GRCm39) M259I probably benign Het
Pdik1l ACCAC ACCACCCCCAC 4: 134,006,823 (GRCm39) probably benign Het
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,468,290 (GRCm39) probably benign Homo
Prag1 C CAGT 8: 36,571,040 (GRCm39) probably benign Homo
Pramel16 G A 4: 143,676,312 (GRCm39) T264M probably damaging Het
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Homo
Raet1d A G 10: 22,247,458 (GRCm39) Q178R probably benign Het
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,231,423 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,784 (GRCm39) probably benign Het
Sp140l1 A C 1: 85,087,072 (GRCm39) N6K probably damaging Het
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 (GRCm39) probably benign Het
Tbr1 A C 2: 61,636,691 (GRCm39) probably benign Het
Tdpoz2 T TCC 3: 93,558,922 (GRCm39) probably null Homo
Tdpoz4 GAA GA 3: 93,704,187 (GRCm39) probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,593,334 (GRCm39) probably benign Homo
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Het
Tob1 CA CAGAA 11: 94,105,303 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,280 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,286 (GRCm39) probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 (GRCm39) probably benign Het
Tsbp1 GC GCAAC 17: 34,679,051 (GRCm39) probably benign Het
Tsbp1 CAG CAGTAG 17: 34,679,034 (GRCm39) probably null Het
Tsbp1 GCA GCATCA 17: 34,679,042 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,027 (GRCm39) probably benign Homo
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Homo
Ubtf TCC TCCCCC 11: 102,197,776 (GRCm39) probably benign Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,561,032 (GRCm39) probably benign Homo
Zfp28 G A 7: 6,397,862 (GRCm39) G766R probably damaging Het
Zfp384 AAGCCCAGGCCCAGGCCCAGGCCCA AAGCCCAGGCCCAAGCCCAGGCCCAGGCCCAGGCCCA 6: 125,013,426 (GRCm39) probably benign Het
Zfp428 G A 7: 24,214,506 (GRCm39) D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,899,757 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,273 (GRCm39) probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,910,186 (GRCm39) probably null Homo
Zfp936 G A 7: 42,838,913 (GRCm39) G127R possibly damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCTCTGAGGAAAGACGC -3'
(R):5'- AGAGGCAGTGCAAAGCTTC -3'

Sequencing Primer
(F):5'- TGGTTCGAGTCCACGGAC -3'
(R):5'- AAAGCTTCAGTCCCTGTGAG -3'
Posted On 2018-04-05