Incidental Mutation 'FR4340:Cacna1f'
List |< first << previous [record 100 of 1113] next >> last >|
ID511198
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #FR4340 ()
Quality Score111.467
Status Not validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGG to AGGCGG at 7620067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably benign
Transcript: ENSMUST00000115725
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115726
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133637
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144522
Predicted Effect probably benign
Transcript: ENSMUST00000155090
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
4930578G10Rik G T 4: 42,761,098 S39I probably benign Het
4932438A13Rik TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,050,752 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530032D15Rik A C 1: 85,109,351 N6K probably damaging Het
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Arpc1b CC CCTGGTC 5: 145,126,792 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
BC051142 CAG CAGTAG 17: 34,460,060 probably null Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
BC051142 GC GCAAC 17: 34,460,077 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,463,767 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,910 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG 19: 47,141,251 probably benign Het
Casz1 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC 4: 148,952,302 probably benign Homo
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,486,316 probably benign Homo
Col2a1 C A 15: 97,988,981 silent Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Crygc A T 1: 65,071,663 F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cyp2d11 T TGGGA 15: 82,390,022 probably null Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dnah8 ACACTGCC AC 17: 30,635,463 probably benign Het
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fam45a CT CTTTT 19: 60,814,621 probably benign Homo
Frem3 CT CTTTT 8: 80,615,241 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,577,152 probably benign Het
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gm16519 A AGAAC 17: 70,929,338 probably null Homo
Gm4340 CAG CAGTAG 10: 104,196,075 probably null Het
Gm4340 GCAG GCAACAG 10: 104,196,098 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 78,842,174 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,386,269 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,712 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CAC CACGAC 11: 99,386,202 probably benign Het
Krt10 ACCG ACCGCCG 11: 99,386,203 probably benign Homo
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,389,274 probably benign Het
Las1l TCCTC TCCTCTACCTC X: 95,940,622 probably benign Het
Lce1a1 C T 3: 92,646,844 G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,697,594 probably benign Het
Lrit3 CTG CTGTTG 3: 129,788,808 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,846 probably benign Het
Mapk7 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG 11: 61,490,206 probably benign Het
Mast4 TTTT TTTTATTT 13: 102,734,857 probably null Het
Mast4 GCA GCAGTGTCA 13: 102,736,317 probably benign Homo
Med12l AGC AGCCGC 3: 59,275,985 probably benign Het
Mfsd5 G A 15: 102,281,161 V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,599,761 probably benign Het
Naip1 A C 13: 100,423,076 M1140R probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Homo
Nefh ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG 11: 4,941,033 probably benign Het
Nefh GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,038 probably benign Homo
Nefh CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,040 probably benign Homo
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nutf2 G T 8: 105,876,570 D78Y probably damaging Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr513 AT ATGATATT 7: 108,754,954 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pdik1l ACCAC ACCACCCCCAC 4: 134,279,512 probably benign Het
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Prag1 C CAGT 8: 36,103,886 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,265,164 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Six3 CGG CGGGGG 17: 85,621,356 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Tbr1 A C 2: 61,806,347 K10N probably benign Het
Tdpoz2 T TCC 3: 93,651,615 probably null Homo
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,616,351 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tob1 AGC AGCCGC 11: 94,214,454 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,460 probably benign Het
Tob1 CA CAGAA 11: 94,214,477 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Triobp TCGG TCGGCGG 15: 78,993,390 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,066 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Homo
Ubtf TCC TCCCCC 11: 102,306,950 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp384 AAGCCCAGGCCCAGGCCCAGGCCCA AAGCCCAGGCCCAAGCCCAGGCCCAGGCCCAGGCCCA 6: 125,036,463 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,480 probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,825,729 probably null Homo
Zfp936 G A 7: 43,189,489 G127R possibly damaging Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 unclassified probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 unclassified probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 unclassified probably benign
IGL02167:Cacna1f APN X 7616019 unclassified probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 unclassified probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 unclassified probably benign
IGL03006:Cacna1f APN X 7626903 unclassified probably damaging 1.00
FR4304:Cacna1f UTSW X 7620061 small insertion probably benign
FR4548:Cacna1f UTSW X 7620058 small insertion probably benign
R0629:Cacna1f UTSW X 7620434 missense probably damaging 0.99
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 splice site probably benign
R2508:Cacna1f UTSW X 7626448 splice site probably benign
R4195:Cacna1f UTSW X 7608930 missense probably damaging 1.00
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R4366:Cacna1f UTSW X 7609974 missense probably damaging 1.00
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCATATAACACTCACTAGG -3'
(R):5'- TGCCTCCTGGGTAGTTCTAG -3'

Sequencing Primer
(F):5'- CTGTTCTAAGAGCTGGGCATACC -3'
(R):5'- CCTGGGTAGTTCTAGGGCTCC -3'
Posted OnApr 05, 2018