Incidental Mutation 'FR4342:Zpld2'
ID 511222
Institutional Source Beutler Lab
Gene Symbol Zpld2
Ensembl Gene ENSMUSG00000073747
Gene Name zona pellucida like domain containing 2
Synonyms Gm7534
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # FR4342 ()
Quality Score 214.458
Status Not validated
Chromosome 4
Chromosomal Location 133918115-133930315 bp(-) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) G to GCTC at 133929942 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
AlphaFold Q3UU21
Predicted Effect probably benign
Transcript: ENSMUST00000097849
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122228
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 125,566,572 (GRCm39) probably null Homo
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
Ankrd35 TCCCC TCCC 3: 96,590,831 (GRCm39) probably null Het
Anxa2 CCC CCCACC 9: 69,387,487 (GRCm39) probably benign Het
Anxa2 C CCCA 9: 69,387,492 (GRCm39) probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,415,052 (GRCm39) probably benign Homo
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 108,999,344 (GRCm39) probably benign Homo
Catsper2 TCA TCAACA 2: 121,228,274 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Homo
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Cimip2b CAGAG CAG 4: 43,427,384 (GRCm39) probably null Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,560,350 (GRCm39) probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,352 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,401 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,733 (GRCm39) probably benign Het
Defa29 C G 8: 21,816,160 (GRCm39) R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,629,032 (GRCm39) probably null Het
Dnaaf9 TCC TCCCCC 2: 130,612,662 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dthd1 C CTTA 5: 63,000,369 (GRCm39) probably benign Homo
E4f1 GC GCCCC 17: 24,674,171 (GRCm39) probably benign Het
F830016B08Rik A ACAG 18: 60,433,013 (GRCm39) probably benign Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,525,991 (GRCm39) probably benign Het
Fbxo22 A C 9: 55,128,354 (GRCm39) probably null Het
Flg G A 3: 93,197,820 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gjc2 T TCCCG 11: 59,073,569 (GRCm39) probably benign Homo
Gm14496 A C 2: 181,637,699 (GRCm39) K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,031,960 (GRCm39) probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,031,927 (GRCm39) probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,607 (GRCm39) probably benign Het
H1f6 TGTGG TG 13: 23,879,896 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Homo
Hoxa3 G GCTT 6: 52,147,110 (GRCm39) probably benign Homo
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Klra10 G A 6: 130,249,710 (GRCm39) R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,800 (GRCm39) probably benign Het
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 ACC ACCCCC 11: 99,277,029 (GRCm39) probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 92,925,554 (GRCm39) probably benign Het
Mak16 T G,A 8: 31,651,777 (GRCm39) E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,183,409 (GRCm39) probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,183,415 (GRCm39) probably benign Het
Mn1 AGC AGCGGC 5: 111,567,572 (GRCm39) probably benign Het
Nacad TC TCAGGGGC 11: 6,549,762 (GRCm39) probably benign Het
Naip1 C T 13: 100,561,979 (GRCm39) R1062K probably benign Het
Ndel1 G A 11: 68,724,235 (GRCm39) P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 35,073,065 (GRCm39) probably benign Het
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Or5p70 G A 7: 107,995,105 (GRCm39) M259I probably benign Het
Or5p70 A G 7: 107,995,100 (GRCm39) T258A probably benign Het
P4ha2 GTGTTGCTG GTG 11: 54,001,077 (GRCm39) probably benign Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,820 (GRCm39) probably benign Homo
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,468,293 (GRCm39) probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,468,290 (GRCm39) probably benign Homo
Pramel16 AAGAG AAG 4: 143,676,327 (GRCm39) probably null Het
Pramel16 G A 4: 143,676,312 (GRCm39) T264M probably damaging Het
Pramel27 AA AATA 4: 143,578,213 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Raet1d A G 10: 22,247,458 (GRCm39) Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 85,682,797 (GRCm39) probably benign Het
Rtbdn GC GCAGCGCC 8: 85,682,807 (GRCm39) probably benign Het
Semp2l2a G C 8: 13,887,613 (GRCm39) H159Q probably benign Het
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,646,821 (GRCm39) probably benign Homo
Sp110 ACT ACTGCT 1: 85,515,209 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 (GRCm39) probably benign Het
Spag17 GGA GGATGA 3: 99,963,565 (GRCm39) probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 99,963,568 (GRCm39) probably benign Homo
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry GGT GGTTGT Y: 2,662,836 (GRCm39) probably benign Het
Sry TGG TGGGGG Y: 2,662,835 (GRCm39) probably benign Het
Sry CTGCTGGTG CTG Y: 2,663,146 (GRCm39) probably benign Het
Sry GGT GGTAGT Y: 2,662,839 (GRCm39) probably benign Homo
Tdpoz3 C T 3: 93,733,819 (GRCm39) P165S probably benign Het
Tdpoz4 GAA GA 3: 93,704,187 (GRCm39) probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,796,419 (GRCm39) probably benign Homo
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 151,018,851 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Trav6n-5 GCTT G 14: 53,342,369 (GRCm39) probably benign Homo
Triobp G GTCA 15: 78,877,592 (GRCm39) probably benign Homo
Tsen2 AGG AGGTGG 6: 115,537,033 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf TC TCCCC 11: 102,197,785 (GRCm39) probably benign Het
Vmn2r125 G A 4: 156,703,260 (GRCm39) V213I probably benign Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zdhhc16 G A 19: 41,930,588 (GRCm39) probably benign Het
Zfp28 G A 7: 6,397,862 (GRCm39) G766R probably damaging Het
Zfp335 GTCGTC GTCGTCGTC 2: 164,749,385 (GRCm39) probably benign Het
Zfp335 C CCCC 2: 164,749,397 (GRCm39) probably benign Het
Zfp428 G A 7: 24,214,506 (GRCm39) D41N probably damaging Homo
Zfp429 A T 13: 67,544,769 (GRCm39) F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,899,754 (GRCm39) probably benign Het
Zfp93 G A 7: 23,975,011 (GRCm39) R332H possibly damaging Het
Other mutations in Zpld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Zpld2 APN 4 133,929,291 (GRCm39) missense probably benign 0.27
IGL03170:Zpld2 APN 4 133,920,345 (GRCm39) missense possibly damaging 0.57
FR4976:Zpld2 UTSW 4 133,929,941 (GRCm39) small insertion probably benign
R0487:Zpld2 UTSW 4 133,930,089 (GRCm39) missense probably damaging 0.97
R0530:Zpld2 UTSW 4 133,930,221 (GRCm39) missense probably benign
R0553:Zpld2 UTSW 4 133,929,829 (GRCm39) missense possibly damaging 0.85
R1121:Zpld2 UTSW 4 133,930,248 (GRCm39) missense probably benign 0.00
R1458:Zpld2 UTSW 4 133,924,144 (GRCm39) missense probably benign 0.01
R1748:Zpld2 UTSW 4 133,929,430 (GRCm39) missense possibly damaging 0.57
R1748:Zpld2 UTSW 4 133,927,610 (GRCm39) missense probably damaging 1.00
R1913:Zpld2 UTSW 4 133,919,986 (GRCm39) critical splice donor site probably null
R2029:Zpld2 UTSW 4 133,929,669 (GRCm39) missense possibly damaging 0.87
R2069:Zpld2 UTSW 4 133,929,252 (GRCm39) missense possibly damaging 0.63
R2237:Zpld2 UTSW 4 133,929,516 (GRCm39) missense unknown
R2239:Zpld2 UTSW 4 133,929,516 (GRCm39) missense unknown
R3943:Zpld2 UTSW 4 133,927,656 (GRCm39) missense probably benign 0.15
R4646:Zpld2 UTSW 4 133,929,459 (GRCm39) missense probably benign 0.00
R4673:Zpld2 UTSW 4 133,927,658 (GRCm39) missense probably benign 0.01
R4838:Zpld2 UTSW 4 133,920,410 (GRCm39) missense probably benign 0.04
R5002:Zpld2 UTSW 4 133,924,231 (GRCm39) missense probably benign 0.09
R5593:Zpld2 UTSW 4 133,920,350 (GRCm39) missense probably damaging 0.99
R5606:Zpld2 UTSW 4 133,927,523 (GRCm39) missense probably benign 0.13
R6553:Zpld2 UTSW 4 133,929,367 (GRCm39) missense probably damaging 0.99
R6834:Zpld2 UTSW 4 133,920,476 (GRCm39) missense possibly damaging 0.95
R6931:Zpld2 UTSW 4 133,920,464 (GRCm39) missense probably benign 0.28
R7526:Zpld2 UTSW 4 133,927,384 (GRCm39) splice site probably null
R7771:Zpld2 UTSW 4 133,922,754 (GRCm39) missense probably benign 0.01
R8271:Zpld2 UTSW 4 133,930,278 (GRCm39) missense unknown
R8725:Zpld2 UTSW 4 133,930,150 (GRCm39) missense probably benign 0.19
R8727:Zpld2 UTSW 4 133,930,150 (GRCm39) missense probably benign 0.19
R8757:Zpld2 UTSW 4 133,930,282 (GRCm39) missense unknown
R8966:Zpld2 UTSW 4 133,929,712 (GRCm39) missense probably damaging 0.98
R8992:Zpld2 UTSW 4 133,929,978 (GRCm39) missense probably damaging 0.99
R9039:Zpld2 UTSW 4 133,922,858 (GRCm39) missense probably damaging 0.98
R9275:Zpld2 UTSW 4 133,922,770 (GRCm39) missense probably damaging 1.00
R9278:Zpld2 UTSW 4 133,922,770 (GRCm39) missense probably damaging 1.00
R9434:Zpld2 UTSW 4 133,929,553 (GRCm39) missense probably benign 0.01
R9458:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9460:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9461:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9480:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9481:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9551:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9552:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
R9553:Zpld2 UTSW 4 133,929,312 (GRCm39) missense probably benign 0.36
RF015:Zpld2 UTSW 4 133,920,338 (GRCm39) missense probably benign
T0975:Zpld2 UTSW 4 133,929,940 (GRCm39) small insertion probably benign
Z1176:Zpld2 UTSW 4 133,929,988 (GRCm39) missense probably benign
Z1176:Zpld2 UTSW 4 133,927,649 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCCAGTTCCAGATGACAGG -3'
(R):5'- CCTTTACACATGACAACTGTGAC -3'

Sequencing Primer
(F):5'- CAGTTCCAGATGACAGGATGGC -3'
(R):5'- GTGACAATTAGGGACACCTCTTC -3'
Posted On 2018-04-05