Incidental Mutation 'FR4589:Gbp2b'
ID 511332
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Name guanylate binding protein 2b
Synonyms Mag-1, Mpa-1, Mpa1, Gbp-1, Gbp1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4589 ()
Quality Score 95.0077
Status Not validated
Chromosome 3
Chromosomal Location 142300608-142324940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142309413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 175 (I175V)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029936
AA Change: I175V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: I175V

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,470,549 (GRCm39) probably benign Homo
Anxa2 C CCCA 9: 69,387,492 (GRCm39) probably benign Het
Apol6 GTTT GTTTTTTT 15: 76,935,638 (GRCm39) probably null Het
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 21,433,919 (GRCm39) probably null Het
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Blm TACC TACCGACC 7: 80,113,518 (GRCm39) probably null Het
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Btnl4 T A 17: 34,691,610 (GRCm39) K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,619,811 (GRCm39) probably benign Het
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Homo
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Chd4 C T 6: 125,099,096 (GRCm39) P1597L probably benign Homo
Chd4 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC 6: 125,099,102 (GRCm39) probably benign Homo
Chga AGC AGCTGC 12: 102,527,661 (GRCm39) probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,560,357 (GRCm39) probably benign Het
Cnpy3 ACCC ACCCCCC 17: 47,047,665 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,080,392 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,080,406 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,401 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,457 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,730 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,733 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,736 (GRCm39) probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,465,749 (GRCm39) probably benign Het
Dclre1a AGGCTTTG AG 19: 56,532,555 (GRCm39) probably benign Het
Dcpp1 A C 17: 24,100,428 (GRCm39) K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 CC CCTGC 2: 130,612,672 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,665 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dthd1 C CTT 5: 63,000,369 (GRCm39) probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Eps8 AC ACTCGC 6: 137,494,067 (GRCm39) probably null Het
Ermn TTC TTCATC 2: 57,938,081 (GRCm39) probably benign Het
Fam81b TC TCTCC 13: 76,419,442 (GRCm39) probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,526,016 (GRCm39) probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,247 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,356,118 (GRCm39) probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG X: 71,313,636 (GRCm39) probably benign Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gm4340 AG AGCCG 10: 104,031,961 (GRCm39) probably benign Het
Gm4340 CAG CAGTAG 10: 104,031,939 (GRCm39) probably null Het
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Ipo9 CCATC CCATCATC 1: 135,314,004 (GRCm39) probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,839,024 (GRCm39) probably benign Homo
Klra9 C G 6: 130,159,366 (GRCm39) D216H probably benign Het
Kmt2b TCC TCCTCCGCC 7: 30,285,806 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,786 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Krt10 TCC TCCGCCGCC 11: 99,280,102 (GRCm39) probably benign Het
Las1l TC TCTTCCAC X: 94,984,231 (GRCm39) probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 94,984,225 (GRCm39) probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 94,984,227 (GRCm39) probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 92,925,575 (GRCm39) probably benign Homo
Loricrin GCCGCCGCC GC 3: 91,989,201 (GRCm39) probably null Het
Lrit3 AC ACATCC 3: 129,597,562 (GRCm39) probably null Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Mapk7 GG GGTGCTAG 11: 61,381,048 (GRCm39) probably benign Het
Med12l GCAACA GCAACAACA 3: 59,183,377 (GRCm39) probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,549,753 (GRCm39) probably benign Het
Ndufc2 G C 7: 97,049,497 (GRCm39) M34I probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 AG AGCCTTTG 14: 38,119,223 (GRCm39) probably benign Het
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,006,680 (GRCm39) probably null Homo
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,006,679 (GRCm39) probably null Homo
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,468,295 (GRCm39) probably benign Het
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prtg G A 9: 72,764,147 (GRCm39) R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,246,817 (GRCm39) probably null Homo
Rhbdf1 A ATTTT 11: 32,164,391 (GRCm39) probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,588,607 (GRCm39) probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 85,682,800 (GRCm39) probably benign Het
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,384,469 (GRCm39) probably benign Het
Shf TCT TCTGCT 2: 122,184,658 (GRCm39) probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,536,115 (GRCm39) probably benign Homo
Six3 CGG CGGAGG 17: 85,928,793 (GRCm39) probably benign Het
Snx1 TCT TCTCCT 9: 66,012,208 (GRCm39) probably benign Homo
Spag17 AGG AGGGGG 3: 99,963,561 (GRCm39) probably benign Het
Spag17 GGA GGATGA 3: 99,963,574 (GRCm39) probably benign Het
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 (GRCm39) probably benign Het
Supt20 A AGCAGCT 3: 54,635,092 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,635,072 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,076 (GRCm39) probably benign Het
Tcof1 GGGTA G 18: 60,961,722 (GRCm39) probably benign Homo
Tert C CAAGGGTGCG 13: 73,796,423 (GRCm39) probably benign Het
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,788,230 (GRCm39) probably null Homo
Tob1 CACA CACAACA 11: 94,105,277 (GRCm39) probably benign Het
Tob1 CA CAGCAA 11: 94,105,303 (GRCm39) probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,149,485 (GRCm39) probably null Homo
Trim16 A AAGC 11: 62,711,521 (GRCm39) probably benign Homo
Tsbp1 GCA GCACCA 17: 34,679,027 (GRCm39) probably benign Het
Tsbp1 AGC AGCCGC 17: 34,679,047 (GRCm39) probably benign Het
Tubgcp4 GTGA G 2: 121,005,944 (GRCm39) probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,223,544 (GRCm39) probably benign Het
Ubtf CTTC CTTCTTC 11: 102,197,771 (GRCm39) probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,197,769 (GRCm39) probably benign Het
Vars1 GTGG GTGGAGTCCTGGTTGG 17: 35,234,964 (GRCm39) probably benign Homo
Vmn2r52 C T 7: 9,892,947 (GRCm39) E731K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,561,038 (GRCm39) probably benign Het
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,561,032 (GRCm39) probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,561,037 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 109,682,733 (GRCm39) probably benign Het
Zfp282 GGC GGCAGC 6: 47,881,725 (GRCm39) probably benign Het
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,753 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,261 (GRCm39) probably benign Het
Zfp997 G A 13: 66,270,022 (GRCm39) S396N probably benign Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142,304,073 (GRCm39) missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142,309,381 (GRCm39) missense probably benign 0.03
IGL01989:Gbp2b APN 3 142,317,201 (GRCm39) missense probably benign 0.19
IGL02019:Gbp2b APN 3 142,312,751 (GRCm39) missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142,309,987 (GRCm39) missense probably benign 0.09
IGL02657:Gbp2b APN 3 142,309,873 (GRCm39) missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142,312,642 (GRCm39) missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
R0329:Gbp2b UTSW 3 142,313,937 (GRCm39) missense probably benign 0.01
R0345:Gbp2b UTSW 3 142,313,944 (GRCm39) missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142,312,550 (GRCm39) missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142,312,739 (GRCm39) missense probably benign
R1163:Gbp2b UTSW 3 142,304,857 (GRCm39) missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142,312,591 (GRCm39) missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142,316,735 (GRCm39) missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142,314,063 (GRCm39) missense probably benign
R1887:Gbp2b UTSW 3 142,314,063 (GRCm39) missense probably benign
R2188:Gbp2b UTSW 3 142,314,040 (GRCm39) missense probably benign 0.44
R2261:Gbp2b UTSW 3 142,312,496 (GRCm39) missense probably benign 0.00
R3977:Gbp2b UTSW 3 142,309,470 (GRCm39) missense probably benign 0.02
R4718:Gbp2b UTSW 3 142,304,756 (GRCm39) missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142,317,171 (GRCm39) missense probably benign 0.21
R4807:Gbp2b UTSW 3 142,304,006 (GRCm39) missense probably benign 0.02
R5042:Gbp2b UTSW 3 142,317,224 (GRCm39) missense probably benign 0.03
R5087:Gbp2b UTSW 3 142,304,015 (GRCm39) missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142,303,946 (GRCm39) missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142,304,852 (GRCm39) missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142,317,126 (GRCm39) missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142,304,806 (GRCm39) missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142,313,919 (GRCm39) missense probably benign
R6030:Gbp2b UTSW 3 142,309,414 (GRCm39) missense probably benign 0.00
R6030:Gbp2b UTSW 3 142,309,414 (GRCm39) missense probably benign 0.00
R6408:Gbp2b UTSW 3 142,323,899 (GRCm39) missense probably benign 0.00
R6500:Gbp2b UTSW 3 142,317,252 (GRCm39) missense probably benign 0.06
R6581:Gbp2b UTSW 3 142,313,999 (GRCm39) nonsense probably null
R6582:Gbp2b UTSW 3 142,316,801 (GRCm39) missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142,303,940 (GRCm39) missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142,306,320 (GRCm39) missense probably benign 0.01
R7120:Gbp2b UTSW 3 142,312,507 (GRCm39) missense probably benign 0.01
R7255:Gbp2b UTSW 3 142,313,878 (GRCm39) missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142,303,920 (GRCm39) missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142,309,370 (GRCm39) missense probably benign 0.07
R8039:Gbp2b UTSW 3 142,323,925 (GRCm39) missense probably benign 0.02
R8312:Gbp2b UTSW 3 142,304,815 (GRCm39) missense probably damaging 0.96
R8312:Gbp2b UTSW 3 142,304,812 (GRCm39) missense probably benign
R8391:Gbp2b UTSW 3 142,309,894 (GRCm39) missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142,309,466 (GRCm39) missense probably benign 0.01
R8721:Gbp2b UTSW 3 142,312,705 (GRCm39) missense possibly damaging 0.93
R8842:Gbp2b UTSW 3 142,312,576 (GRCm39) missense probably benign
R8849:Gbp2b UTSW 3 142,313,913 (GRCm39) missense probably benign 0.00
R8874:Gbp2b UTSW 3 142,314,040 (GRCm39) missense probably benign 0.03
R8896:Gbp2b UTSW 3 142,309,327 (GRCm39) missense probably damaging 1.00
R8992:Gbp2b UTSW 3 142,316,730 (GRCm39) missense probably benign 0.00
R9339:Gbp2b UTSW 3 142,317,178 (GRCm39) missense probably benign 0.01
R9752:Gbp2b UTSW 3 142,313,917 (GRCm39) missense probably benign 0.16
Z1177:Gbp2b UTSW 3 142,310,077 (GRCm39) missense possibly damaging 0.90
Predicted Primers
Posted On 2018-04-05