Incidental Mutation 'FR4589:Fbrsl1'
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Namefibrosin-like 1
Synonyms2410025L10Rik, LOC381668
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #FR4589 ()
Quality Score217.468
Status Not validated
Chromosomal Location110361754-110448503 bp(-) (GRCm38)
Type of Mutationsmall insertion (4 aa in frame mutation)
DNA Base Change (assembly) TG to TGCGTGTGCTGGCG at 110378150 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056124] [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768] [ENSMUST00000198834]
Predicted Effect probably benign
Transcript: ENSMUST00000056124
SMART Domains Protein: ENSMUSP00000054613
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 125 329 3.1e-96 PFAM
low complexity region 464 480 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069483
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196801
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198768
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323

low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198834
SMART Domains Protein: ENSMUSP00000143147
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 150 353 4.1e-107 PFAM
low complexity region 488 504 N/A INTRINSIC
low complexity region 522 537 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,669,531 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Kmt2b TCC TCCTCCGCC 7: 30,586,381 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrit3 AC ACATCC 3: 129,803,913 probably null Het
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,651 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,655 probably benign Het
Supt20 A AGCAGCT 3: 54,727,671 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4931:Fbrsl1 UTSW 5 110379029 missense possibly damaging 0.89
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6168:Fbrsl1 UTSW 5 110396056 missense probably damaging 0.97
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
R7269:Fbrsl1 UTSW 5 110433014 missense probably benign 0.15
R7514:Fbrsl1 UTSW 5 110432933 missense probably benign 0.06
R7586:Fbrsl1 UTSW 5 110378154 missense probably damaging 0.99
R7791:Fbrsl1 UTSW 5 110448019 missense probably benign 0.00
R8108:Fbrsl1 UTSW 5 110378379 splice site probably null
R8182:Fbrsl1 UTSW 5 110378995 missense possibly damaging 0.46
R8679:Fbrsl1 UTSW 5 110378220 missense probably damaging 1.00
RF008:Fbrsl1 UTSW 5 110378118 small insertion probably benign
RF029:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF031:Fbrsl1 UTSW 5 110378151 small insertion probably benign
RF033:Fbrsl1 UTSW 5 110378125 small insertion probably benign
RF034:Fbrsl1 UTSW 5 110378149 small insertion probably benign
RF037:Fbrsl1 UTSW 5 110378151 nonsense probably null
RF061:Fbrsl1 UTSW 5 110378131 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378143 small insertion probably benign
RF064:Fbrsl1 UTSW 5 110378131 small insertion probably benign
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05