Incidental Mutation 'FR4589:Kmt2b'
ID 511350
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Name lysine (K)-specific methyltransferase 2B
Synonyms 2610014H22Rik, Mll2, Wbp7
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # FR4589 ()
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 30268283-30288151 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CCTCCT to CCTCCTGCTCCT at 30285786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108150
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108151
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185080
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,470,549 (GRCm39) probably benign Homo
Anxa2 C CCCA 9: 69,387,492 (GRCm39) probably benign Het
Apol6 GTTT GTTTTTTT 15: 76,935,638 (GRCm39) probably null Het
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 21,433,919 (GRCm39) probably null Het
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Blm TACC TACCGACC 7: 80,113,518 (GRCm39) probably null Het
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Btnl4 T A 17: 34,691,610 (GRCm39) K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,619,811 (GRCm39) probably benign Het
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Homo
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Chd4 C T 6: 125,099,096 (GRCm39) P1597L probably benign Homo
Chd4 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC 6: 125,099,102 (GRCm39) probably benign Homo
Chga AGC AGCTGC 12: 102,527,661 (GRCm39) probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,560,357 (GRCm39) probably benign Het
Cnpy3 ACCC ACCCCCC 17: 47,047,665 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,080,392 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,080,406 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,401 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,457 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,730 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,733 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,736 (GRCm39) probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,465,749 (GRCm39) probably benign Het
Dclre1a AGGCTTTG AG 19: 56,532,555 (GRCm39) probably benign Het
Dcpp1 A C 17: 24,100,428 (GRCm39) K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 CC CCTGC 2: 130,612,672 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,665 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dthd1 C CTT 5: 63,000,369 (GRCm39) probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Eps8 AC ACTCGC 6: 137,494,067 (GRCm39) probably null Het
Ermn TTC TTCATC 2: 57,938,081 (GRCm39) probably benign Het
Fam81b TC TCTCC 13: 76,419,442 (GRCm39) probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,526,016 (GRCm39) probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,247 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,356,118 (GRCm39) probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG X: 71,313,636 (GRCm39) probably benign Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 AG AGCCG 10: 104,031,961 (GRCm39) probably benign Het
Gm4340 CAG CAGTAG 10: 104,031,939 (GRCm39) probably null Het
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,314,004 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,839,024 (GRCm39) probably benign Homo
Klra9 C G 6: 130,159,366 (GRCm39) D216H probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,280,102 (GRCm39) probably benign Het
Las1l TC TCTTCCAC X: 94,984,231 (GRCm39) probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 94,984,225 (GRCm39) probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 94,984,227 (GRCm39) probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 92,925,575 (GRCm39) probably benign Homo
Loricrin GCCGCCGCC GC 3: 91,989,201 (GRCm39) probably null Het
Lrit3 AC ACATCC 3: 129,597,562 (GRCm39) probably null Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Mapk7 GG GGTGCTAG 11: 61,381,048 (GRCm39) probably benign Het
Med12l GCAACA GCAACAACA 3: 59,183,377 (GRCm39) probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,549,753 (GRCm39) probably benign Het
Ndufc2 G C 7: 97,049,497 (GRCm39) M34I probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 AG AGCCTTTG 14: 38,119,223 (GRCm39) probably benign Het
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,006,680 (GRCm39) probably null Homo
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,006,679 (GRCm39) probably null Homo
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,468,295 (GRCm39) probably benign Het
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prtg G A 9: 72,764,147 (GRCm39) R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,246,817 (GRCm39) probably null Homo
Rhbdf1 A ATTTT 11: 32,164,391 (GRCm39) probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,588,607 (GRCm39) probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 85,682,800 (GRCm39) probably benign Het
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,384,469 (GRCm39) probably benign Het
Shf TCT TCTGCT 2: 122,184,658 (GRCm39) probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,536,115 (GRCm39) probably benign Homo
Six3 CGG CGGAGG 17: 85,928,793 (GRCm39) probably benign Het
Snx1 TCT TCTCCT 9: 66,012,208 (GRCm39) probably benign Homo
Spag17 AGG AGGGGG 3: 99,963,561 (GRCm39) probably benign Het
Spag17 GGA GGATGA 3: 99,963,574 (GRCm39) probably benign Het
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 (GRCm39) probably benign Het
Supt20 A AGCAGCT 3: 54,635,092 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,635,072 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,076 (GRCm39) probably benign Het
Tcof1 GGGTA G 18: 60,961,722 (GRCm39) probably benign Homo
Tert C CAAGGGTGCG 13: 73,796,423 (GRCm39) probably benign Het
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,788,230 (GRCm39) probably null Homo
Tob1 CACA CACAACA 11: 94,105,277 (GRCm39) probably benign Het
Tob1 CA CAGCAA 11: 94,105,303 (GRCm39) probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,149,485 (GRCm39) probably null Homo
Trim16 A AAGC 11: 62,711,521 (GRCm39) probably benign Homo
Tsbp1 GCA GCACCA 17: 34,679,027 (GRCm39) probably benign Het
Tsbp1 AGC AGCCGC 17: 34,679,047 (GRCm39) probably benign Het
Tubgcp4 GTGA G 2: 121,005,944 (GRCm39) probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,223,544 (GRCm39) probably benign Het
Ubtf CTTC CTTCTTC 11: 102,197,771 (GRCm39) probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,197,769 (GRCm39) probably benign Het
Vars1 GTGG GTGGAGTCCTGGTTGG 17: 35,234,964 (GRCm39) probably benign Homo
Vmn2r52 C T 7: 9,892,947 (GRCm39) E731K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,561,038 (GRCm39) probably benign Het
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,561,032 (GRCm39) probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,561,037 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 109,682,733 (GRCm39) probably benign Het
Zfp282 GGC GGCAGC 6: 47,881,725 (GRCm39) probably benign Het
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,753 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,261 (GRCm39) probably benign Het
Zfp997 G A 13: 66,270,022 (GRCm39) S396N probably benign Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30,285,938 (GRCm39) unclassified probably benign
IGL00821:Kmt2b APN 7 30,270,038 (GRCm39) missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30,279,352 (GRCm39) missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30,279,932 (GRCm39) missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30,268,939 (GRCm39) critical splice donor site probably null
IGL01949:Kmt2b APN 7 30,276,586 (GRCm39) splice site probably null
IGL02253:Kmt2b APN 7 30,281,152 (GRCm39) missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30,278,303 (GRCm39) critical splice donor site probably null
IGL02493:Kmt2b APN 7 30,268,936 (GRCm39) unclassified probably benign
IGL02504:Kmt2b APN 7 30,285,968 (GRCm39) unclassified probably benign
IGL02532:Kmt2b APN 7 30,286,314 (GRCm39) unclassified probably benign
IGL02698:Kmt2b APN 7 30,278,118 (GRCm39) splice site probably benign
IGL02717:Kmt2b APN 7 30,282,869 (GRCm39) missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30,276,569 (GRCm39) missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30,274,887 (GRCm39) missense probably benign 0.02
IGL03386:Kmt2b APN 7 30,273,396 (GRCm39) missense possibly damaging 0.94
Dean UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
provost UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
tenure UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
3-1:Kmt2b UTSW 7 30,269,040 (GRCm39) nonsense probably null
FR4304:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4342:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4548:Kmt2b UTSW 7 30,285,805 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,806 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
FR4737:Kmt2b UTSW 7 30,285,795 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,792 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,803 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,787 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,785 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,798 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
PIT4403001:Kmt2b UTSW 7 30,285,114 (GRCm39) missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30,278,996 (GRCm39) missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30,276,217 (GRCm39) splice site probably benign
R0131:Kmt2b UTSW 7 30,283,346 (GRCm39) missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30,273,618 (GRCm39) missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30,276,180 (GRCm39) missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30,274,365 (GRCm39) missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30,279,912 (GRCm39) missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30,276,385 (GRCm39) splice site probably benign
R1599:Kmt2b UTSW 7 30,270,000 (GRCm39) missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30,283,387 (GRCm39) missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30,285,275 (GRCm39) missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30,274,083 (GRCm39) missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30,274,776 (GRCm39) missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30,268,845 (GRCm39) missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30,282,812 (GRCm39) missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30,273,490 (GRCm39) missense probably benign 0.25
R2401:Kmt2b UTSW 7 30,276,133 (GRCm39) missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30,275,493 (GRCm39) missense probably benign 0.10
R3436:Kmt2b UTSW 7 30,276,117 (GRCm39) missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30,273,489 (GRCm39) missense probably benign 0.25
R4259:Kmt2b UTSW 7 30,280,506 (GRCm39) missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30,281,261 (GRCm39) critical splice donor site probably null
R4388:Kmt2b UTSW 7 30,288,015 (GRCm39) unclassified probably benign
R4542:Kmt2b UTSW 7 30,279,684 (GRCm39) missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30,285,783 (GRCm39) unclassified probably benign
R4722:Kmt2b UTSW 7 30,282,627 (GRCm39) missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30,276,186 (GRCm39) nonsense probably null
R4916:Kmt2b UTSW 7 30,277,942 (GRCm39) missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30,269,265 (GRCm39) missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30,269,219 (GRCm39) missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30,281,098 (GRCm39) missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30,279,869 (GRCm39) missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30,276,570 (GRCm39) missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30,287,902 (GRCm39) unclassified probably benign
R6727:Kmt2b UTSW 7 30,283,984 (GRCm39) missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30,285,701 (GRCm39) unclassified probably benign
R7048:Kmt2b UTSW 7 30,268,731 (GRCm39) missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30,279,388 (GRCm39) missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30,279,896 (GRCm39) missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30,281,385 (GRCm39) missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30,268,978 (GRCm39) missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30,282,656 (GRCm39) missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30,279,208 (GRCm39) missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30,276,199 (GRCm39) missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30,268,802 (GRCm39) missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30,268,756 (GRCm39) missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30,284,894 (GRCm39) missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30,278,347 (GRCm39) missense probably damaging 0.99
R8802:Kmt2b UTSW 7 30,283,496 (GRCm39) missense probably damaging 1.00
R8954:Kmt2b UTSW 7 30,273,640 (GRCm39) missense probably damaging 1.00
R9046:Kmt2b UTSW 7 30,285,479 (GRCm39) missense probably benign 0.00
R9225:Kmt2b UTSW 7 30,286,172 (GRCm39) missense unknown
R9258:Kmt2b UTSW 7 30,281,893 (GRCm39) missense probably null 0.99
R9414:Kmt2b UTSW 7 30,282,307 (GRCm39) missense probably damaging 0.99
R9468:Kmt2b UTSW 7 30,284,513 (GRCm39) missense probably damaging 0.98
R9508:Kmt2b UTSW 7 30,269,259 (GRCm39) missense probably damaging 0.99
R9642:Kmt2b UTSW 7 30,283,340 (GRCm39) critical splice donor site probably null
R9667:Kmt2b UTSW 7 30,287,784 (GRCm39) missense unknown
R9709:Kmt2b UTSW 7 30,279,228 (GRCm39) missense probably damaging 0.98
RF001:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF006:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF020:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF021:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
RF030:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF035:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
X0067:Kmt2b UTSW 7 30,278,998 (GRCm39) missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30,284,676 (GRCm39) missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30,276,795 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30,285,841 (GRCm39) missense unknown
Z1177:Kmt2b UTSW 7 30,283,588 (GRCm39) missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30,274,449 (GRCm39) missense probably benign 0.08
Z1186:Kmt2b UTSW 7 30,284,732 (GRCm39) missense probably benign
Z1186:Kmt2b UTSW 7 30,274,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCTTCCTAGAGCATGTAGC -3'
(R):5'- TGTTTCCAAGGCCAAGAAAGTG -3'

Sequencing Primer
(F):5'- AGGAGACTCTTCCTGCTTCTCTG -3'
(R):5'- TTTCCAAGGCCAAGAAAGTGAAGATG -3'
Posted On 2018-04-05