Incidental Mutation 'FR4589:Cluh'
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #FR4589 ()
Quality Score217.468
Status Not validated
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) AGCC to AGCCTGGGCC at 74669531 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000092915] [ENSMUST00000102520] [ENSMUST00000117818]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021091
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745

LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092915
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741

Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102520
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745

LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117818
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741

Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156794
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,378,150 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCC TCCTCCGCC 7: 30,586,381 probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrit3 AC ACATCC 3: 129,803,913 probably null Het
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,651 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,655 probably benign Het
Supt20 A AGCAGCT 3: 54,727,671 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
R9061:Cluh UTSW 11 74660366 missense possibly damaging 0.73
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05