Incidental Mutation 'FR4589:Zc3h13'
ID 511409
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Name zinc finger CCCH type containing 13
Synonyms 3110050K21Rik, C87618, 4930570G11Rik, 2600010B19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # FR4589 ()
Quality Score 217.468
Status Not validated
Chromosome 14
Chromosomal Location 75521813-75581866 bp(+) (GRCm39)
Type of Mutation small insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGTGCGAG to TGTGCGAGGAGTGCGAG at 75561037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold E9Q784
Predicted Effect probably benign
Transcript: ENSMUST00000022577
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226417
Predicted Effect probably benign
Transcript: ENSMUST00000227049
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T A 15: 85,378,508 (GRCm39) E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,470,549 (GRCm39) probably benign Homo
Anxa2 C CCCA 9: 69,387,492 (GRCm39) probably benign Het
Apol6 GTTT GTTTTTTT 15: 76,935,638 (GRCm39) probably null Het
Arrb2 C T 11: 70,329,497 (GRCm39) T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 21,433,919 (GRCm39) probably null Het
Bcas3 G A 11: 85,400,323 (GRCm39) V431I probably benign Homo
Blm TACC TACCGACC 7: 80,113,518 (GRCm39) probably null Het
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Btnl4 T A 17: 34,691,610 (GRCm39) K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,619,811 (GRCm39) probably benign Het
Cd164 G T 10: 41,397,922 (GRCm39) A59S probably benign Homo
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Homo
Chd4 C T 6: 125,099,096 (GRCm39) P1597L probably benign Homo
Chd4 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC 6: 125,099,102 (GRCm39) probably benign Homo
Chga AGC AGCTGC 12: 102,527,661 (GRCm39) probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,560,357 (GRCm39) probably benign Het
Cnpy3 ACCC ACCCCCC 17: 47,047,665 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,080,392 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,080,406 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,401 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Het
Col6a5 A T 9: 105,811,373 (GRCm39) N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,457 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,730 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,733 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,736 (GRCm39) probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,465,749 (GRCm39) probably benign Het
Dclre1a AGGCTTTG AG 19: 56,532,555 (GRCm39) probably benign Het
Dcpp1 A C 17: 24,100,428 (GRCm39) K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 CC CCTGC 2: 130,612,672 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,665 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dthd1 C CTT 5: 63,000,369 (GRCm39) probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Eps8 AC ACTCGC 6: 137,494,067 (GRCm39) probably null Het
Ermn TTC TTCATC 2: 57,938,081 (GRCm39) probably benign Het
Fam81b TC TCTCC 13: 76,419,442 (GRCm39) probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,526,016 (GRCm39) probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,247 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,356,118 (GRCm39) probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG X: 71,313,636 (GRCm39) probably benign Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 AG AGCCG 10: 104,031,961 (GRCm39) probably benign Het
Gm4340 CAG CAGTAG 10: 104,031,939 (GRCm39) probably null Het
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Ipo9 CCATC CCATCATC 1: 135,314,004 (GRCm39) probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,839,024 (GRCm39) probably benign Homo
Klra9 C G 6: 130,159,366 (GRCm39) D216H probably benign Het
Kmt2b TCC TCCTCCGCC 7: 30,285,806 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,786 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Krt10 TCC TCCGCCGCC 11: 99,280,102 (GRCm39) probably benign Het
Las1l TC TCTTCCAC X: 94,984,231 (GRCm39) probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 94,984,225 (GRCm39) probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 94,984,227 (GRCm39) probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 92,925,575 (GRCm39) probably benign Homo
Loricrin GCCGCCGCC GC 3: 91,989,201 (GRCm39) probably null Het
Lrit3 AC ACATCC 3: 129,597,562 (GRCm39) probably null Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Mapk7 GG GGTGCTAG 11: 61,381,048 (GRCm39) probably benign Het
Med12l GCAACA GCAACAACA 3: 59,183,377 (GRCm39) probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,549,753 (GRCm39) probably benign Het
Ndufc2 G C 7: 97,049,497 (GRCm39) M34I probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 AG AGCCTTTG 14: 38,119,223 (GRCm39) probably benign Het
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,006,680 (GRCm39) probably null Homo
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,006,679 (GRCm39) probably null Homo
Phaf1 G A 8: 105,967,730 (GRCm39) G207E probably benign Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,468,295 (GRCm39) probably benign Het
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prtg G A 9: 72,764,147 (GRCm39) R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,246,817 (GRCm39) probably null Homo
Rhbdf1 A ATTTT 11: 32,164,391 (GRCm39) probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,588,607 (GRCm39) probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 85,682,800 (GRCm39) probably benign Het
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,384,469 (GRCm39) probably benign Het
Shf TCT TCTGCT 2: 122,184,658 (GRCm39) probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,536,115 (GRCm39) probably benign Homo
Six3 CGG CGGAGG 17: 85,928,793 (GRCm39) probably benign Het
Snx1 TCT TCTCCT 9: 66,012,208 (GRCm39) probably benign Homo
Spag17 AGG AGGGGG 3: 99,963,561 (GRCm39) probably benign Het
Spag17 GGA GGATGA 3: 99,963,574 (GRCm39) probably benign Het
Speer4a1 C A 5: 26,241,746 (GRCm39) E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 (GRCm39) probably benign Het
Supt20 A AGCAGCT 3: 54,635,092 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,635,072 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,076 (GRCm39) probably benign Het
Tcof1 GGGTA G 18: 60,961,722 (GRCm39) probably benign Homo
Tert C CAAGGGTGCG 13: 73,796,423 (GRCm39) probably benign Het
Tmbim7 C T 5: 3,720,064 (GRCm39) R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,788,230 (GRCm39) probably null Homo
Tob1 CACA CACAACA 11: 94,105,277 (GRCm39) probably benign Het
Tob1 CA CAGCAA 11: 94,105,303 (GRCm39) probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,149,485 (GRCm39) probably null Homo
Trim16 A AAGC 11: 62,711,521 (GRCm39) probably benign Homo
Tsbp1 GCA GCACCA 17: 34,679,027 (GRCm39) probably benign Het
Tsbp1 AGC AGCCGC 17: 34,679,047 (GRCm39) probably benign Het
Tubgcp4 GTGA G 2: 121,005,944 (GRCm39) probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,223,544 (GRCm39) probably benign Het
Ubtf CTTC CTTCTTC 11: 102,197,771 (GRCm39) probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,197,769 (GRCm39) probably benign Het
Vars1 GTGG GTGGAGTCCTGGTTGG 17: 35,234,964 (GRCm39) probably benign Homo
Vmn2r52 C T 7: 9,892,947 (GRCm39) E731K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 109,682,733 (GRCm39) probably benign Het
Zfp282 GGC GGCAGC 6: 47,881,725 (GRCm39) probably benign Het
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,753 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,261 (GRCm39) probably benign Het
Zfp997 G A 13: 66,270,022 (GRCm39) S396N probably benign Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75,567,587 (GRCm39) missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75,573,439 (GRCm39) missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75,547,163 (GRCm39) missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75,581,209 (GRCm39) utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75,567,787 (GRCm39) missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75,569,206 (GRCm39) missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75,531,381 (GRCm39) missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75,531,416 (GRCm39) missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75,553,479 (GRCm39) missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75,561,050 (GRCm39) small insertion probably benign
FR4304:Zc3h13 UTSW 14 75,561,043 (GRCm39) small insertion probably benign
FR4340:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4449:Zc3h13 UTSW 14 75,561,041 (GRCm39) nonsense probably null
FR4548:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,038 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,036 (GRCm39) small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75,569,323 (GRCm39) missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75,560,694 (GRCm39) missense unknown
R0374:Zc3h13 UTSW 14 75,546,405 (GRCm39) missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75,560,922 (GRCm39) missense unknown
R0408:Zc3h13 UTSW 14 75,529,626 (GRCm39) nonsense probably null
R0967:Zc3h13 UTSW 14 75,581,179 (GRCm39) missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75,553,424 (GRCm39) missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75,574,923 (GRCm39) nonsense probably null
R2021:Zc3h13 UTSW 14 75,567,635 (GRCm39) missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75,569,587 (GRCm39) missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75,546,380 (GRCm39) nonsense probably null
R3745:Zc3h13 UTSW 14 75,568,101 (GRCm39) missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75,567,178 (GRCm39) missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75,565,041 (GRCm39) missense unknown
R4799:Zc3h13 UTSW 14 75,576,863 (GRCm39) missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75,576,836 (GRCm39) missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75,573,449 (GRCm39) missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75,581,059 (GRCm39) missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75,568,687 (GRCm39) missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75,568,348 (GRCm39) missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75,569,400 (GRCm39) nonsense probably null
R5726:Zc3h13 UTSW 14 75,568,269 (GRCm39) missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75,565,572 (GRCm39) missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75,568,149 (GRCm39) missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75,574,849 (GRCm39) missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75,581,176 (GRCm39) missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75,567,863 (GRCm39) missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75,546,355 (GRCm39) missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75,560,998 (GRCm39) small deletion probably benign
R6598:Zc3h13 UTSW 14 75,569,623 (GRCm39) missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75,568,597 (GRCm39) missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75,559,227 (GRCm39) missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75,559,161 (GRCm39) missense unknown
R7307:Zc3h13 UTSW 14 75,567,981 (GRCm39) missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75,546,349 (GRCm39) missense unknown
R7680:Zc3h13 UTSW 14 75,567,955 (GRCm39) missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75,568,070 (GRCm39) missense not run
R8048:Zc3h13 UTSW 14 75,561,977 (GRCm39) missense unknown
R8059:Zc3h13 UTSW 14 75,565,250 (GRCm39) missense unknown
R8362:Zc3h13 UTSW 14 75,561,909 (GRCm39) missense unknown
R8391:Zc3h13 UTSW 14 75,568,625 (GRCm39) missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75,569,512 (GRCm39) missense probably benign 0.05
R9081:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9082:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9101:Zc3h13 UTSW 14 75,561,042 (GRCm39) missense unknown
R9214:Zc3h13 UTSW 14 75,560,991 (GRCm39) missense unknown
R9308:Zc3h13 UTSW 14 75,565,418 (GRCm39) missense unknown
R9376:Zc3h13 UTSW 14 75,561,128 (GRCm39) missense unknown
R9618:Zc3h13 UTSW 14 75,567,542 (GRCm39) missense
R9665:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
Z1177:Zc3h13 UTSW 14 75,565,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGAGACTCCAGAGACATGCG -3'
(R):5'- TAGAACTCTCTTCTCTCAGGTGG -3'

Sequencing Primer
(F):5'- TCCAGAGACATGCGGGACTC -3'
(R):5'- CAGGTGGTTTCTGCCATAACTGC -3'
Posted On 2018-04-05