Incidental Mutation 'FR4589:Tcof1'
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4589 ()
Quality Score214.458
Status Not validated
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) GGGTA to G at 60828650 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176088
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,669,531 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,378,150 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCC TCCTCCGCC 7: 30,586,381 probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrit3 AC ACATCC 3: 129,803,913 probably null Het
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,651 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,655 probably benign Het
Supt20 A AGCAGCT 3: 54,727,671 probably benign Het
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 splice site probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60838762 missense probably damaging 1.00
R8192:Tcof1 UTSW 18 60843303 missense probably damaging 1.00
R8200:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8203:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8204:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8207:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8217:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8300:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8517:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8518:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8553:Tcof1 UTSW 18 60831571 missense possibly damaging 0.92
R8729:Tcof1 UTSW 18 60829073 missense unknown
R8732:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8749:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF007:Tcof1 UTSW 18 60833568 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835735 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05