Incidental Mutation 'FR4449:Tmc2'
ID 511447
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Name transmembrane channel-like gene family 2
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # FR4449 ()
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130037114-130106365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 130082116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 433 (V433G)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
AlphaFold Q8R4P4
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: V433G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: V433G

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: V433G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: V433G

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 GGTATTGCATTTCTTATCT G 5: 4,031,214 (GRCm39) probably benign Homo
Amfr C G 8: 94,731,787 (GRCm39) G30R probably damaging Homo
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AGC AGCCAATAACGC 18: 34,415,058 (GRCm39) probably benign Het
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apol6 TTT TTTGATT 15: 76,935,643 (GRCm39) probably null Homo
Arid1b CGG CGGTGG 17: 5,045,864 (GRCm39) probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,523,387 (GRCm39) probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,656 (GRCm39) probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Btnl10 AAG AAGGAG 11: 58,814,754 (GRCm39) probably benign Homo
Cacna1a ACC ACCCCC 8: 85,365,343 (GRCm39) probably benign Het
Cacna1a ACC ACCGCC 8: 85,365,352 (GRCm39) probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,349 (GRCm39) probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,129,713 (GRCm39) probably benign Het
Ccdc15 C CTTTAT 9: 37,226,454 (GRCm39) probably null Het
Ccdc85c CCG CCGACG 12: 108,240,875 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,873,737 (GRCm39) probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,296,982 (GRCm39) probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,152,953 (GRCm39) probably benign Het
Cfap46 T C 7: 139,218,711 (GRCm39) probably benign Homo
Cgref1 TTC TTCGTC 5: 31,091,120 (GRCm39) probably benign Het
Cgref1 CTT CTTATT 5: 31,091,122 (GRCm39) probably null Homo
Cluh G GACTGAA 11: 74,560,358 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cpne1 CCTACT CCT 2: 155,915,422 (GRCm39) probably benign Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,461 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,782 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,739 (GRCm39) probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,465,749 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,727 (GRCm39) probably benign Het
Dhx8 G GAGACCC 11: 101,629,033 (GRCm39) probably benign Het
Dhx8 CG CGAGACAG 11: 101,629,020 (GRCm39) probably benign Homo
Dhx8 AGACCG AGACCGTGACCG 11: 101,629,010 (GRCm39) probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,629,016 (GRCm39) probably benign Het
Dhx8 CG CGAGACAG 11: 101,629,032 (GRCm39) probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,326,254 (GRCm39) probably benign Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,469,150 (GRCm39) probably benign Homo
Ermn CTT CTTGTT 2: 57,938,086 (GRCm39) probably benign Het
Fgd6 GGAT G 10: 93,880,182 (GRCm39) probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,504,901 (GRCm39) probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,624,353 (GRCm39) probably benign Homo
Gatad2b AGAC A 3: 90,249,224 (GRCm39) probably benign Het
Gigyf2 C T 1: 87,356,307 (GRCm39) probably benign Het
Gm16519 A AGAT 17: 71,236,333 (GRCm39) probably benign Homo
Gm4340 AGC AGCGGC 10: 104,031,946 (GRCm39) probably benign Het
Gm4340 GCA GCATCA 10: 104,031,947 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 79,149,597 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,605 (GRCm39) probably benign Het
Gpatch11 GG GGCAGACG 17: 79,149,610 (GRCm39) probably benign Het
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,812,264 (GRCm39) probably benign Homo
Igsf10 G A 3: 59,226,531 (GRCm39) R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 26,804,635 (GRCm39) probably benign Het
Ints5 G A 19: 8,874,594 (GRCm39) R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,839,020 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kifc5b A C 17: 27,143,191 (GRCm39) E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,198,809 (GRCm39) probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,794 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,786 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Krt10 ACC ACCACCTCC 11: 99,280,093 (GRCm39) probably benign Het
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 92,925,459 (GRCm39) probably benign Het
Leo1 GTACCATGCA G 9: 75,357,855 (GRCm39) probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,339,364 (GRCm39) probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,532,752 (GRCm39) probably benign Homo
Med12l CAG CAGTAG 3: 59,183,384 (GRCm39) probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,468,735 (GRCm39) probably benign Homo
Mn1 GCA GCAACA 5: 111,567,576 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Nat8f2 T A 6: 85,844,668 (GRCm39) L231F possibly damaging Homo
Noc2l C CTGA 4: 156,324,558 (GRCm39) probably benign Het
Nrg3 T TAGACAC 14: 38,119,228 (GRCm39) probably benign Het
Or8b41 A G 9: 38,054,484 (GRCm39) I13V probably benign Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,532,927 (GRCm39) probably null Homo
Pik3ap1 G GGAA 19: 41,270,385 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,891,422 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Qrich2 AACT A 11: 116,347,025 (GRCm39) probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,246,814 (GRCm39) probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,599,166 (GRCm39) probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,809,376 (GRCm39) probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 24,164,338 (GRCm39) probably benign Het
Setd1a G A 7: 127,384,498 (GRCm39) probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,646,812 (GRCm39) probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,373,065 (GRCm39) probably benign Homo
Six3 CGG CGGGGG 17: 85,928,790 (GRCm39) probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 124,996,136 (GRCm39) probably benign Homo
Slc26a8 CTCTCTG C 17: 28,857,290 (GRCm39) probably benign Het
Spata31h1 TTCAGT TT 10: 82,121,303 (GRCm39) probably null Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry TGCTG TGCTGCTG Y: 2,662,832 (GRCm39) probably benign Homo
Sry ACTG ACTGCTG Y: 2,662,818 (GRCm39) probably benign Het
Ston1 G A 17: 88,942,953 (GRCm39) V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,070 (GRCm39) probably benign Het
Tbl3 TG TGTGG 17: 24,921,518 (GRCm39) probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,595,646 (GRCm39) probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 (GRCm39) probably benign Homo
Tmprss13 G A 9: 45,239,856 (GRCm39) A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tob1 CAG CAGAAG 11: 94,105,294 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,301 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Homo
Triobp GTC GTCTTC 15: 78,877,589 (GRCm39) probably benign Het
Ubtf CCT CCTACT 11: 102,197,774 (GRCm39) probably null Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Xpnpep3 G C 15: 81,311,623 (GRCm39) D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,561,041 (GRCm39) probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 109,682,726 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 CTCT CTCTTCT 2: 164,749,403 (GRCm39) probably benign Het
Zfp335 CTC CTCATC 2: 164,749,397 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,759 (GRCm39) probably benign Het
Zfp831 TCC TCCACC 2: 174,487,264 (GRCm39) probably benign Het
Zfp831 CTC CTCGTC 2: 174,487,275 (GRCm39) probably benign Het
Zfp978 G T 4: 147,475,401 (GRCm39) S316I probably benign Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130,103,224 (GRCm39) missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130,105,932 (GRCm39) missense probably benign 0.02
IGL01094:Tmc2 APN 2 130,102,086 (GRCm39) splice site probably benign
IGL01331:Tmc2 APN 2 130,074,276 (GRCm39) missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130,102,144 (GRCm39) nonsense probably null
IGL01926:Tmc2 APN 2 130,102,160 (GRCm39) missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130,082,073 (GRCm39) missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130,071,126 (GRCm39) missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130,082,050 (GRCm39) missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130,071,107 (GRCm39) missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130,068,182 (GRCm39) missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130,090,571 (GRCm39) missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130,044,023 (GRCm39) missense probably benign 0.00
R1183:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130,090,650 (GRCm39) missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130,090,682 (GRCm39) missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130,089,880 (GRCm39) missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130,089,854 (GRCm39) missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130,098,036 (GRCm39) missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130,102,145 (GRCm39) missense probably benign 0.34
R1776:Tmc2 UTSW 2 130,076,789 (GRCm39) missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130,090,676 (GRCm39) missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130,056,584 (GRCm39) splice site probably benign
R2020:Tmc2 UTSW 2 130,074,305 (GRCm39) missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130,056,483 (GRCm39) splice site probably null
R3968:Tmc2 UTSW 2 130,043,991 (GRCm39) missense probably benign 0.02
R4732:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4733:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4989:Tmc2 UTSW 2 130,043,961 (GRCm39) missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130,076,738 (GRCm39) missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130,082,035 (GRCm39) missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130,083,564 (GRCm39) missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130,074,306 (GRCm39) missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130,106,123 (GRCm39) missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130,103,300 (GRCm39) missense probably benign
R7132:Tmc2 UTSW 2 130,074,329 (GRCm39) missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130,076,724 (GRCm39) missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130,038,497 (GRCm39) critical splice donor site probably null
R8167:Tmc2 UTSW 2 130,083,488 (GRCm39) missense probably benign 0.04
R8554:Tmc2 UTSW 2 130,106,084 (GRCm39) missense probably benign 0.00
R9134:Tmc2 UTSW 2 130,074,321 (GRCm39) missense probably benign 0.21
R9169:Tmc2 UTSW 2 130,083,516 (GRCm39) missense probably damaging 1.00
R9209:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R9232:Tmc2 UTSW 2 130,085,049 (GRCm39) missense probably damaging 1.00
R9725:Tmc2 UTSW 2 130,089,881 (GRCm39) missense probably damaging 0.99
X0019:Tmc2 UTSW 2 130,050,205 (GRCm39) missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130,043,892 (GRCm39) missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130,050,216 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCTGGCTTGGTGCTATTCAC -3'
(R):5'- ACAAGGCCTGTAATTCAGACTTTC -3'

Sequencing Primer
(F):5'- ACCTCTCCTTTTCACATGCTAAGGAG -3'
(R):5'- GACTTTCTGAGACTCTACTGCAGAAC -3'
Posted On 2018-04-05