Incidental Mutation 'FR4449:Vps13b'
ID 511533
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4449 ()
Quality Score 221.999
Status Not validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35847103 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Alanine to Serine at position 2629 (A2629S)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: A2629S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: A2629S

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227567
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 GGTATTGCATTTCTTATCT G 5: 4,031,214 (GRCm39) probably benign Homo
Amfr C G 8: 94,731,787 (GRCm39) G30R probably damaging Homo
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AGC AGCCAATAACGC 18: 34,415,058 (GRCm39) probably benign Het
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apol6 TTT TTTGATT 15: 76,935,643 (GRCm39) probably null Homo
Arid1b CGG CGGTGG 17: 5,045,864 (GRCm39) probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,523,387 (GRCm39) probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,656 (GRCm39) probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Btnl10 AAG AAGGAG 11: 58,814,754 (GRCm39) probably benign Homo
Cacna1a ACC ACCCCC 8: 85,365,343 (GRCm39) probably benign Het
Cacna1a ACC ACCGCC 8: 85,365,352 (GRCm39) probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,349 (GRCm39) probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,129,713 (GRCm39) probably benign Het
Ccdc15 C CTTTAT 9: 37,226,454 (GRCm39) probably null Het
Ccdc85c CCG CCGACG 12: 108,240,875 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,873,737 (GRCm39) probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,296,982 (GRCm39) probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,152,953 (GRCm39) probably benign Het
Cfap46 T C 7: 139,218,711 (GRCm39) probably benign Homo
Cgref1 TTC TTCGTC 5: 31,091,120 (GRCm39) probably benign Het
Cgref1 CTT CTTATT 5: 31,091,122 (GRCm39) probably null Homo
Cluh G GACTGAA 11: 74,560,358 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cpne1 CCTACT CCT 2: 155,915,422 (GRCm39) probably benign Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,461 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,782 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,739 (GRCm39) probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,465,749 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,465,727 (GRCm39) probably benign Het
Dhx8 CG CGAGACAG 11: 101,629,020 (GRCm39) probably benign Homo
Dhx8 CG CGAGACAG 11: 101,629,032 (GRCm39) probably benign Het
Dhx8 G GAGACCC 11: 101,629,033 (GRCm39) probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,629,010 (GRCm39) probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,629,016 (GRCm39) probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,326,254 (GRCm39) probably benign Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,469,150 (GRCm39) probably benign Homo
Ermn CTT CTTGTT 2: 57,938,086 (GRCm39) probably benign Het
Fgd6 GGAT G 10: 93,880,182 (GRCm39) probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,504,901 (GRCm39) probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,624,353 (GRCm39) probably benign Homo
Gatad2b AGAC A 3: 90,249,224 (GRCm39) probably benign Het
Gigyf2 C T 1: 87,356,307 (GRCm39) probably benign Het
Gm16519 A AGAT 17: 71,236,333 (GRCm39) probably benign Homo
Gm4340 AGC AGCGGC 10: 104,031,946 (GRCm39) probably benign Het
Gm4340 GCA GCATCA 10: 104,031,947 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 79,149,597 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,605 (GRCm39) probably benign Het
Gpatch11 GG GGCAGACG 17: 79,149,610 (GRCm39) probably benign Het
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,812,264 (GRCm39) probably benign Homo
Igsf10 G A 3: 59,226,531 (GRCm39) R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 26,804,635 (GRCm39) probably benign Het
Ints5 G A 19: 8,874,594 (GRCm39) R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,839,020 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kifc5b A C 17: 27,143,191 (GRCm39) E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,198,809 (GRCm39) probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,794 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,786 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Krt10 ACC ACCACCTCC 11: 99,280,093 (GRCm39) probably benign Het
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 92,925,459 (GRCm39) probably benign Het
Leo1 GTACCATGCA G 9: 75,357,855 (GRCm39) probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,339,364 (GRCm39) probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,532,752 (GRCm39) probably benign Homo
Med12l CAG CAGTAG 3: 59,183,384 (GRCm39) probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,468,735 (GRCm39) probably benign Homo
Mn1 GCA GCAACA 5: 111,567,576 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Nat8f2 T A 6: 85,844,668 (GRCm39) L231F possibly damaging Homo
Noc2l C CTGA 4: 156,324,558 (GRCm39) probably benign Het
Nrg3 T TAGACAC 14: 38,119,228 (GRCm39) probably benign Het
Or8b41 A G 9: 38,054,484 (GRCm39) I13V probably benign Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,532,927 (GRCm39) probably null Homo
Pik3ap1 G GGAA 19: 41,270,385 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,891,422 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Qrich2 AACT A 11: 116,347,025 (GRCm39) probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,246,814 (GRCm39) probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,599,166 (GRCm39) probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,809,376 (GRCm39) probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 24,164,338 (GRCm39) probably benign Het
Setd1a G A 7: 127,384,498 (GRCm39) probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,646,812 (GRCm39) probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,373,065 (GRCm39) probably benign Homo
Six3 CGG CGGGGG 17: 85,928,790 (GRCm39) probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 124,996,136 (GRCm39) probably benign Homo
Slc26a8 CTCTCTG C 17: 28,857,290 (GRCm39) probably benign Het
Spata31h1 TTCAGT TT 10: 82,121,303 (GRCm39) probably null Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry TGCTG TGCTGCTG Y: 2,662,832 (GRCm39) probably benign Homo
Sry ACTG ACTGCTG Y: 2,662,818 (GRCm39) probably benign Het
Ston1 G A 17: 88,942,953 (GRCm39) V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,070 (GRCm39) probably benign Het
Tbl3 TG TGTGG 17: 24,921,518 (GRCm39) probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,595,646 (GRCm39) probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 (GRCm39) probably benign Homo
Tmc2 T G 2: 130,082,116 (GRCm39) V433G probably damaging Het
Tmprss13 G A 9: 45,239,856 (GRCm39) A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tob1 CAG CAGAAG 11: 94,105,294 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,301 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Homo
Triobp GTC GTCTTC 15: 78,877,589 (GRCm39) probably benign Het
Ubtf CCT CCTACT 11: 102,197,774 (GRCm39) probably null Het
Xpnpep3 G C 15: 81,311,623 (GRCm39) D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,561,041 (GRCm39) probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 109,682,726 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,749,397 (GRCm39) probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,749,403 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,759 (GRCm39) probably benign Het
Zfp831 TCC TCCACC 2: 174,487,264 (GRCm39) probably benign Het
Zfp831 CTC CTCGTC 2: 174,487,275 (GRCm39) probably benign Het
Zfp978 G T 4: 147,475,401 (GRCm39) S316I probably benign Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTAAAACAATGGCCACTGGG -3'
(R):5'- CATGCTTACCAGGGAGCATG -3'

Sequencing Primer
(F):5'- CACTGGGCAGACAGCTG -3'
(R):5'- AGCATGGCCTGTGAGCATTC -3'
Posted On 2018-04-05