Incidental Mutation 'FR4737:Arpc1b'
ID 511632
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Name actin related protein 2/3 complex, subunit 1B
Synonyms L72, p41-ARC, SOP2Hs
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4737 ()
Quality Score 128.467
Status Not validated
Chromosome 5
Chromosomal Location 145051066-145064996 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GGTGGC to GGTGGCGTGGC at 145063597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031627] [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000196111] [ENSMUST00000141602]
AlphaFold Q9WV32
Predicted Effect probably benign
Transcript: ENSMUST00000031627
SMART Domains Protein: ENSMUSP00000031627
Gene: ENSMUSG00000029623

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:PP28 84 163 3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085679
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000196111
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138922
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect probably benign
Transcript: ENSMUST00000141602
SMART Domains Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-15 BLAST
PDB:2P9U|C 1 56 2e-33 PDB
SCOP:d1k8kc_ 9 56 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 211 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,634,882 (GRCm39) probably benign Het
A630001G21Rik CTGTT CT 1: 85,650,856 (GRCm39) probably benign Homo
Abcb11 C A 2: 69,073,862 (GRCm39) R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,946,597 (GRCm39) probably benign Homo
Ahdc1 CT CTCGT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTACT 7: 80,727,510 (GRCm39) probably benign Het
Amfr C G 8: 94,731,787 (GRCm39) G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,591,165 (GRCm39) probably benign Homo
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,415,052 (GRCm39) probably benign Homo
Apol6 GTTT GTTTCTTT 15: 76,935,642 (GRCm39) probably null Homo
AY358078 C T 14: 52,043,155 (GRCm39) S281L unknown Homo
Blm ACCTGC ACCTGCCTGC 7: 80,113,519 (GRCm39) probably null Het
Blm T TACCA 7: 80,113,522 (GRCm39) probably null Het
Bltp1 TTATTAT TTATTATTATTATTACTATTAT 3: 37,104,903 (GRCm39) probably benign Het
Blzf1 TTGT TT 1: 164,131,486 (GRCm39) probably null Homo
Btnl10 A AAGG 11: 58,814,757 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,349 (GRCm39) probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,355 (GRCm39) probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,228,021 (GRCm39) probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,511,023 (GRCm39) probably benign Het
Ccdc170 AC ACCCC 10: 4,511,029 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdan1 A C 2: 120,555,452 (GRCm39) V763G probably damaging Het
Cdk6 A G 5: 3,394,211 (GRCm39) probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,152,946 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,950 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCCC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GAGCCT GAGCCTAAGCCT 11: 74,560,350 (GRCm39) probably benign Het
Cluh CC CCTGAGGC 11: 74,560,359 (GRCm39) probably benign Het
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,560,340 (GRCm39) probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,560,345 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,408 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,416 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,080,402 (GRCm39) probably benign Het
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cul9 CTC CTCTTC 17: 46,811,784 (GRCm39) probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,811,772 (GRCm39) probably benign Het
Cyth2 C A 7: 45,462,466 (GRCm39) S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,739 (GRCm39) probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,465,752 (GRCm39) probably benign Het
Dennd2b CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,156,128 (GRCm39) probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,629,005 (GRCm39) probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,629,015 (GRCm39) probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,008 (GRCm39) probably benign Homo
Dnaaf9 CC CCTGC 2: 130,612,672 (GRCm39) probably benign Het
Dnah8 CCTCCCG C 17: 30,854,451 (GRCm39) probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,854,439 (GRCm39) probably benign Het
Dnajb5 AGGTG A 4: 42,957,126 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,674,166 (GRCm39) probably benign Homo
Eif3a TTA TTATTATA 19: 60,763,727 (GRCm39) probably benign Het
Fam81b TTC TTCGTC 13: 76,419,438 (GRCm39) probably benign Het
Fbxo22 G A 9: 55,116,666 (GRCm39) R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,191,820 (GRCm39) probably null Het
Fcgr1 T C 3: 96,194,410 (GRCm39) D159G probably benign Homo
Fmn1 CC CCTCCTTC 2: 113,356,129 (GRCm39) probably benign Het
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,356,123 (GRCm39) probably benign Het
Fmn1 CC CCCCCTGC 2: 113,356,126 (GRCm39) probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,504,899 (GRCm39) probably null Het
Gli3 G A 13: 15,818,942 (GRCm39) R248H probably damaging Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,591,527 (GRCm39) probably null Het
Gm4340 AGC AGCTGC 10: 104,031,958 (GRCm39) probably benign Het
Gm4340 AG AGCGG 10: 104,031,961 (GRCm39) probably benign Het
Gm4340 GCA GCAACA 10: 104,031,938 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 79,149,609 (GRCm39) probably benign Het
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Hrh1 T C 6: 114,458,084 (GRCm39) I455T possibly damaging Het
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Iba57 GAAA GAAAAA 11: 59,052,331 (GRCm39) probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGAGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,179,977 (GRCm39) probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,179,913 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,198,815 (GRCm39) probably null Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,285,792 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,795 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,803 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,791 (GRCm39) probably benign Het
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,277,023 (GRCm39) probably benign Homo
Krt10 TCC TCCTCCACC 11: 99,280,105 (GRCm39) probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,019,844 (GRCm39) probably benign Homo
Krtap4-2 A ACAC 11: 99,525,839 (GRCm39) probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,488,830 (GRCm39) probably benign Het
Las1l AGG AGGGGG X: 94,984,427 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,435 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,433 (GRCm39) probably benign Het
Lrit3 AC ACATTC 3: 129,597,562 (GRCm39) probably null Homo
Lrit3 TGC TGCAGC 3: 129,582,455 (GRCm39) probably benign Het
Lrit3 GCT GCTTCT 3: 129,582,459 (GRCm39) probably benign Het
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,270,507 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,441 (GRCm39) probably benign Het
Mamld1 GCA GCAACA X: 70,162,445 (GRCm39) probably benign Het
Mapk8ip3 G A 17: 25,121,093 (GRCm39) probably null Homo
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,406,644 (GRCm39) probably benign Het
Nat8f2 T A 6: 85,844,668 (GRCm39) L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,716,464 (GRCm39) probably benign Het
Noc2l GGTAG GG 4: 156,325,958 (GRCm39) probably benign Homo
Noc2l CTG CTGTTG 4: 156,324,552 (GRCm39) probably benign Het
Noc2l GCT GCTTCT 4: 156,324,551 (GRCm39) probably benign Het
Nxpe5 C T 5: 138,228,196 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51a43 G C 7: 103,720,499 (GRCm39) probably benign Homo
Or51f2 CT CTAATTGCCTT 7: 102,526,440 (GRCm39) probably benign Homo
Or8b41 A G 9: 38,054,484 (GRCm39) I13V probably benign Homo
Or8u3-ps CAG CAGAG 2: 85,953,104 (GRCm39) probably null Homo
Osmr C CTCA 15: 6,867,187 (GRCm39) probably null Homo
Patl2 GC GCTAC 2: 121,956,625 (GRCm39) probably null Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 CTG CTGTTG 2: 121,956,617 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,006,678 (GRCm39) probably null Homo
Phc1 GCTG GCTGCTTCTG 6: 122,300,557 (GRCm39) probably benign Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Pla2g4e AGGG A 2: 120,075,205 (GRCm39) probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,468,295 (GRCm39) probably benign Het
Pnma8a CCTCATGATGCACCTGCTTCAACATC CCTCATGATGCACCTGCTTCAACATCTCATGATGCACCTGCTTCAACATC 7: 16,695,350 (GRCm39) probably benign Homo
Pnma8b TGGA T 7: 16,679,931 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,370,608 (GRCm39) probably benign Het
Prss41 CACA C 17: 24,063,071 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Het
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,891,420 (GRCm39) probably benign Homo
Ptms C CTTG 6: 124,891,424 (GRCm39) probably benign Homo
Ptms TTC TTCGTC 6: 124,891,422 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rab3il1 C A 19: 10,011,115 (GRCm39) A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,659,954 (GRCm39) probably null Homo
Rtbdn AGCG AGCGTCCGCG 8: 85,682,797 (GRCm39) probably benign Het
Rtbdn TAG TAGGGGCAG 8: 85,682,790 (GRCm39) probably benign Het
Rtbdn GGC GGCAGCTGC 8: 85,682,806 (GRCm39) probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 85,682,805 (GRCm39) probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 24,164,356 (GRCm39) probably benign Het
Sbp G GCTGACAACAAAGATC 17: 24,164,363 (GRCm39) probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,384,484 (GRCm39) probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,646,820 (GRCm39) probably benign Het
Six3 GGC GGCAGC 17: 85,928,785 (GRCm39) probably benign Het
Six3 GCG GCGCCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,790 (GRCm39) probably benign Het
Six3 GGC GGCAGC 17: 85,928,791 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,793 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,796 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 124,996,134 (GRCm39) probably benign Homo
Smarca2 CAGCAGCAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,399 (GRCm39) probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 (GRCm39) probably benign Het
Spag1 TTC TTCGTC 15: 36,197,879 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,573 (GRCm39) probably benign Het
Spata31h1 TTCA T 10: 82,121,303 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Srpk2 T C 5: 23,750,194 (GRCm39) probably null Homo
Sry AACTGCT A Y: 2,663,195 (GRCm39) probably benign Het
Sry GTG GTGTTG Y: 2,662,837 (GRCm39) probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 (GRCm39) probably benign Homo
Stard9 C CTAAGGGACTAGTAGG 2: 120,526,566 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,079 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,635,082 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,635,078 (GRCm39) probably benign Het
Tcof1 GGGTA G 18: 60,961,722 (GRCm39) probably benign Homo
Tdpoz3 A C 3: 93,733,981 (GRCm39) N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 (GRCm39) probably null Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CACA CACAACA 11: 94,105,277 (GRCm39) probably benign Het
Tob1 A AGCC 11: 94,105,304 (GRCm39) probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,887,213 (GRCm39) probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Homo
Trim63 GAGT G 4: 134,055,036 (GRCm39) probably benign Het
Tsbp1 CAG CAGAAG 17: 34,679,025 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,042 (GRCm39) probably benign Het
Tsen2 G GAGA 6: 115,537,038 (GRCm39) probably benign Het
Ttf2 TC TCCCC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,223,550 (GRCm39) probably benign Homo
Ubqlnl TGAG T 7: 103,799,042 (GRCm39) probably benign Homo
Ubtf CCT CCTACT 11: 102,197,774 (GRCm39) probably null Het
Ubtf TCC TCCACC 11: 102,197,776 (GRCm39) probably benign Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wasf3 G T 5: 146,407,060 (GRCm39) R460L probably damaging Het
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,561,039 (GRCm39) probably benign Homo
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,561,036 (GRCm39) probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 109,682,720 (GRCm39) probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 109,682,735 (GRCm39) probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 109,682,734 (GRCm39) probably benign Het
Zfp111 TCA TCAACA 7: 23,899,230 (GRCm39) probably benign Homo
Zfp112 CATGA CATGATGA 7: 23,824,832 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,881,733 (GRCm39) probably benign Het
Zfp282 CGG CGGGGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TC TCCCC 2: 164,749,404 (GRCm39) probably benign Het
Zfp335 TCC TCCGCC 2: 164,749,395 (GRCm39) probably benign Het
Zfp335 CTC CTCGTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp598 AC ACCACCGC 17: 24,899,765 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,264 (GRCm39) probably benign Het
Zfp831 CTC CTCATC 2: 174,487,269 (GRCm39) probably benign Het
Zfp831 TC TCCGC 2: 174,487,276 (GRCm39) probably benign Het
Zfp93 CAGGCATAG CAG 7: 23,974,814 (GRCm39) probably benign Homo
Zscan10 TGACG TG 17: 23,828,419 (GRCm39) probably benign Homo
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145,064,679 (GRCm39) utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145,058,555 (GRCm39) splice site probably null
IGL01859:Arpc1b APN 5 145,060,540 (GRCm39) missense probably damaging 0.98
illusory UTSW 5 145,059,377 (GRCm39) missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145,063,601 (GRCm39) frame shift probably null
FR4340:Arpc1b UTSW 5 145,063,602 (GRCm39) frame shift probably null
R0110:Arpc1b UTSW 5 145,064,525 (GRCm39) missense probably damaging 1.00
R0245:Arpc1b UTSW 5 145,063,670 (GRCm39) missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145,064,525 (GRCm39) missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145,063,670 (GRCm39) missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145,062,566 (GRCm39) missense probably benign 0.34
R1117:Arpc1b UTSW 5 145,062,564 (GRCm39) missense possibly damaging 0.95
R1453:Arpc1b UTSW 5 145,062,555 (GRCm39) missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145,059,443 (GRCm39) missense probably null 0.99
R1946:Arpc1b UTSW 5 145,059,443 (GRCm39) missense probably null 0.99
R2050:Arpc1b UTSW 5 145,062,729 (GRCm39) missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145,060,579 (GRCm39) missense probably damaging 0.99
R4924:Arpc1b UTSW 5 145,063,625 (GRCm39) missense probably benign 0.02
R6534:Arpc1b UTSW 5 145,059,377 (GRCm39) missense probably damaging 1.00
R6883:Arpc1b UTSW 5 145,063,739 (GRCm39) missense probably benign 0.31
R8523:Arpc1b UTSW 5 145,061,492 (GRCm39) missense probably damaging 1.00
R8854:Arpc1b UTSW 5 145,060,405 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCCTACTTGATACATCTAGGG -3'
(R):5'- CAGCTCTCAGAGTGGTTCTTAG -3'

Sequencing Primer
(F):5'- ATTTCCTGGTAGCCCTCAGAGG -3'
(R):5'- TTAGGTCTCTGGAAGCACCTGAC -3'
Posted On 2018-04-05