Incidental Mutation 'FR4737:Kmt2b'
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4737 ()
Quality Score217.468
Status Not validated
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCCTCC to TCCTCCCCCTCC at 30586378 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108150
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310

ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108151
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310

BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185080
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 208 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,668,448 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4932415D10Rik TTCA T 10: 82,285,469 probably benign Homo
4932438A13Rik TTATTAT TTATTATTATTATTACTATTAT 3: 37,050,754 probably benign Het
A630001G21Rik CTGTT CT 1: 85,723,135 probably benign Homo
Abcb11 C A 2: 69,243,518 R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,896,597 probably benign Homo
Ahdc1 CT CTCGT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTACT 7: 81,077,762 probably benign Het
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,683,849 probably benign Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,281,999 probably benign Homo
Apol6 GTTT GTTTCTTT 15: 77,051,442 probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,126,787 probably null Het
AY358078 C T 14: 51,805,698 S281L unknown Homo
BC051142 CAG CAGAAG 17: 34,460,051 probably benign Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
Blm ACCTGC ACCTGCCTGC 7: 80,463,771 probably null Het
Blm T TACCA 7: 80,463,774 probably null Het
Blzf1 TTGT TT 1: 164,303,917 probably null Homo
Btnl10 A AAGG 11: 58,923,931 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,726 probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,397,540 probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCCC 10: 4,561,029 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdan1 A C 2: 120,724,971 V763G probably damaging Het
Cdk6 A G 5: 3,344,211 probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,019,874 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,878 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCCC 6: 125,122,131 probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,669,519 probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,669,524 probably benign Het
Cluh CC CCTGAGGC 11: 74,669,533 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,189,576 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,582 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,590 probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,500,846 probably benign Het
Cul9 CTC CTCTTC 17: 46,500,858 probably benign Het
Cyth2 C A 7: 45,813,042 S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,583,699 probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,738,179 probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,182 probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,738,189 probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,635,465 probably benign Het
Dnah8 CCTCCCG C 17: 30,635,477 probably benign Homo
Dnajb5 AGGTG A 4: 42,957,126 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,455,192 probably benign Homo
Eif3a TTA TTATTATA 19: 60,775,289 probably benign Het
Fam81b TTC TTCGTC 13: 76,271,319 probably benign Het
Fbxo22 G A 9: 55,209,382 R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,284,504 probably null Het
Fcgr1 T C 3: 96,287,094 D159G probably benign Homo
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,525,778 probably benign Het
Fmn1 CC CCCCCTGC 2: 113,525,781 probably benign Het
Fmn1 CC CCTCCTTC 2: 113,525,784 probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,577,178 probably null Het
Gli3 G A 13: 15,644,357 R248H probably damaging Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,857,602 probably null Het
Gm4340 GCA GCAACA 10: 104,196,077 probably benign Het
Gm4340 AGC AGCTGC 10: 104,196,097 probably benign Het
Gm4340 AG AGCGG 10: 104,196,100 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 78,842,180 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Hrh1 T C 6: 114,481,123 I455T possibly damaging Het
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Iba57 GAAA GAAAAA 11: 59,161,505 probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Il17rd CGG CGGAGG 14: 27,082,680 probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,125,828 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,221,852 probably null Het
Krt10 TCCGCC TCCGCCGCC 11: 99,386,197 probably benign Homo
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,389,273 probably benign Het
Krt10 TCC TCCTCCACC 11: 99,389,279 probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Homo
Krtap4-2 A ACAC 11: 99,635,013 probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,598,004 probably benign Het
Las1l AGG AGGGGG X: 95,940,821 probably benign Het
Las1l AGG AGGCGG X: 95,940,827 probably benign Het
Las1l GAG GAGCAG X: 95,940,829 probably benign Het
Lrit3 TGC TGCAGC 3: 129,788,806 probably benign Het
Lrit3 GCT GCTTCT 3: 129,788,810 probably benign Het
Lrit3 AC ACATTC 3: 129,803,913 probably null Homo
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,543,196 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mapk8ip3 G A 17: 24,902,119 probably null Homo
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,559,121 probably benign Het
Noc2l GCT GCTTCT 4: 156,240,094 probably benign Het
Noc2l CTG CTGTTG 4: 156,240,095 probably benign Het
Noc2l GGTAG GG 4: 156,241,501 probably benign Homo
Nxpe5 C T 5: 138,229,934 probably benign Het
Olfr1038-ps CAG CAGAG 2: 86,122,760 probably null Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr568 CT CTAATTGCCTT 7: 102,877,233 probably benign Homo
Olfr644 G C 7: 104,071,292 probably benign Homo
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Osmr C CTCA 15: 6,837,706 probably null Homo
Patl2 CTG CTGTTG 2: 122,126,136 probably benign Het
Patl2 GC GCTAC 2: 122,126,144 probably null Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,323,598 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Pla2g4e AGGG A 2: 120,244,724 probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,479,863 probably benign Het
Pnmal2 TGGA T 7: 16,946,006 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,462,173 probably benign Het
Prss41 CACA C 17: 23,844,097 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Het
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,914,457 probably benign Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Homo
Ptms C CTTG 6: 124,914,461 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rab3il1 C A 19: 10,033,751 A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,782,755 probably null Homo
Rtbdn TAG TAGGGGCAG 8: 84,956,161 probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 84,956,168 probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 84,956,176 probably benign Het
Rtbdn GGC GGCAGCTGC 8: 84,956,177 probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 23,945,382 probably benign Het
Sbp G GCTGACAACAAAGATC 17: 23,945,389 probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,785,312 probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,569,756 probably benign Het
Six3 GGC GGCAGC 17: 85,621,357 probably benign Het
Six3 GCG GCGCCG 17: 85,621,358 probably benign Het
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Six3 GGC GGCAGC 17: 85,621,363 probably benign Het
Six3 CGG CGGGGG 17: 85,621,365 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 125,154,214 probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 probably benign Het
Spag1 TTC TTCGTC 15: 36,197,733 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,257 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Srpk2 T C 5: 23,545,196 probably null Homo
Sry GTG GTGTTG Y: 2,662,837 probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 probably benign Homo
Sry AACTGCT A Y: 2,663,195 probably benign Het
Stard9 C CTAAGGGACTAGTAGG 2: 120,696,085 probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,658 probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,727,661 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tdpoz3 A C 3: 93,826,674 N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 A AGCC 11: 94,214,478 probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,649,756 probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Homo
Trim63 GAGT G 4: 134,327,725 probably benign Het
Tsen2 G GAGA 6: 115,560,077 probably benign Het
Ttf2 TC TCCCC 3: 100,963,160 probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,313 probably benign Homo
Ubqlnl TGAG T 7: 104,149,835 probably benign Homo
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Ubtf TCC TCCACC 11: 102,306,950 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wasf3 G T 5: 146,470,250 R460L probably damaging Het
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,323,596 probably benign Homo
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,323,599 probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 108,956,088 probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 108,956,102 probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 108,956,103 probably benign Het
Zfp111 TCA TCAACA 7: 24,199,805 probably benign Homo
Zfp112 CATGA CATGATGA 7: 24,125,407 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,904,790 probably benign Het
Zfp282 CGG CGGGGG 6: 47,904,799 probably benign Het
Zfp335 CTC CTCGTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCGCC 2: 164,907,475 probably benign Het
Zfp335 TC TCCCC 2: 164,907,484 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,680,782 probably benign Het
Zfp598 AC ACCACCGC 17: 24,680,791 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCATC 2: 174,645,476 probably benign Het
Zfp831 TC TCCGC 2: 174,645,483 probably benign Het
Zfp93 CAGGCATAG CAG 7: 24,275,389 probably benign Homo
Zscan10 TGACG TG 17: 23,609,445 probably benign Homo
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
ivoire UTSW 7 30584559 missense probably damaging 0.98
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
PIT4403001:Kmt2b UTSW 7 30585689 missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30579571 missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30579963 missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30580471 missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30581960 missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30569410 missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30569553 missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30582208 missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30583231 missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30579783 missense probably damaging 1.00
R7964:Kmt2b UTSW 7 30579783 missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30576774 missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30569377 missense probably damaging 0.98
RF001:Kmt2b UTSW 7 30586382 unclassified probably benign
RF006:Kmt2b UTSW 7 30586377 unclassified probably benign
RF020:Kmt2b UTSW 7 30586382 unclassified probably benign
RF021:Kmt2b UTSW 7 30586357 unclassified probably benign
RF030:Kmt2b UTSW 7 30586377 unclassified probably benign
RF035:Kmt2b UTSW 7 30586357 unclassified probably benign
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30577370 missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30575024 missense probably benign 0.08
Z1177:Kmt2b UTSW 7 30584163 missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30586416 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05