Incidental Mutation 'FR4737:Ccdc170'
ID 511688
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Name coiled-coil domain containing 170
Synonyms Gm221, LOC237250
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # FR4737 ()
Quality Score 188.468
Status Not validated
Chromosome 10
Chromosomal Location 4432502-4512231 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) ACC to ACCTCC at 4511023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112]
AlphaFold D3YXL0
Predicted Effect probably benign
Transcript: ENSMUST00000019901
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138112
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 210 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,634,882 (GRCm39) probably benign Het
A630001G21Rik CTGTT CT 1: 85,650,856 (GRCm39) probably benign Homo
Abcb11 C A 2: 69,073,862 (GRCm39) R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,946,597 (GRCm39) probably benign Homo
Ahdc1 CT CTCGT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTACT 7: 80,727,510 (GRCm39) probably benign Het
Amfr C G 8: 94,731,787 (GRCm39) G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,591,165 (GRCm39) probably benign Homo
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,415,052 (GRCm39) probably benign Homo
Apol6 GTTT GTTTCTTT 15: 76,935,642 (GRCm39) probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,063,597 (GRCm39) probably null Het
AY358078 C T 14: 52,043,155 (GRCm39) S281L unknown Homo
Blm ACCTGC ACCTGCCTGC 7: 80,113,519 (GRCm39) probably null Het
Blm T TACCA 7: 80,113,522 (GRCm39) probably null Het
Bltp1 TTATTAT TTATTATTATTATTACTATTAT 3: 37,104,903 (GRCm39) probably benign Het
Blzf1 TTGT TT 1: 164,131,486 (GRCm39) probably null Homo
Btnl10 A AAGG 11: 58,814,757 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,349 (GRCm39) probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,355 (GRCm39) probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,228,021 (GRCm39) probably benign Homo
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdan1 A C 2: 120,555,452 (GRCm39) V763G probably damaging Het
Cdk6 A G 5: 3,394,211 (GRCm39) probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,152,946 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,950 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCCC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,560,340 (GRCm39) probably benign Het
Cluh CC CCTGAGGC 11: 74,560,359 (GRCm39) probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,560,350 (GRCm39) probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,560,345 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,416 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,408 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,080,402 (GRCm39) probably benign Het
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cul9 CTC CTCTTC 17: 46,811,784 (GRCm39) probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,811,772 (GRCm39) probably benign Het
Cyth2 C A 7: 45,462,466 (GRCm39) S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,739 (GRCm39) probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,465,752 (GRCm39) probably benign Het
Dennd2b CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,156,128 (GRCm39) probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,629,005 (GRCm39) probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,629,015 (GRCm39) probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,008 (GRCm39) probably benign Homo
Dnaaf9 CC CCTGC 2: 130,612,672 (GRCm39) probably benign Het
Dnah8 CCTCCCG C 17: 30,854,451 (GRCm39) probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,854,439 (GRCm39) probably benign Het
Dnajb5 AGGTG A 4: 42,957,126 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,674,166 (GRCm39) probably benign Homo
Eif3a TTA TTATTATA 19: 60,763,727 (GRCm39) probably benign Het
Fam81b TTC TTCGTC 13: 76,419,438 (GRCm39) probably benign Het
Fbxo22 G A 9: 55,116,666 (GRCm39) R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,191,820 (GRCm39) probably null Het
Fcgr1 T C 3: 96,194,410 (GRCm39) D159G probably benign Homo
Fmn1 CC CCTCCTTC 2: 113,356,129 (GRCm39) probably benign Het
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,356,123 (GRCm39) probably benign Het
Fmn1 CC CCCCCTGC 2: 113,356,126 (GRCm39) probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,504,899 (GRCm39) probably null Het
Gli3 G A 13: 15,818,942 (GRCm39) R248H probably damaging Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,591,527 (GRCm39) probably null Het
Gm4340 AGC AGCTGC 10: 104,031,958 (GRCm39) probably benign Het
Gm4340 AG AGCGG 10: 104,031,961 (GRCm39) probably benign Het
Gm4340 GCA GCAACA 10: 104,031,938 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 79,149,609 (GRCm39) probably benign Het
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Hrh1 T C 6: 114,458,084 (GRCm39) I455T possibly damaging Het
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Iba57 GAAA GAAAAA 11: 59,052,331 (GRCm39) probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGAGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,179,977 (GRCm39) probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,179,913 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,198,815 (GRCm39) probably null Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,285,792 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,795 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,803 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,791 (GRCm39) probably benign Het
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,277,023 (GRCm39) probably benign Homo
Krt10 TCC TCCTCCACC 11: 99,280,105 (GRCm39) probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,019,844 (GRCm39) probably benign Homo
Krtap4-2 A ACAC 11: 99,525,839 (GRCm39) probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,488,830 (GRCm39) probably benign Het
Las1l AGG AGGGGG X: 94,984,427 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,435 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,433 (GRCm39) probably benign Het
Lrit3 TGC TGCAGC 3: 129,582,455 (GRCm39) probably benign Het
Lrit3 AC ACATTC 3: 129,597,562 (GRCm39) probably null Homo
Lrit3 GCT GCTTCT 3: 129,582,459 (GRCm39) probably benign Het
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,270,507 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,441 (GRCm39) probably benign Het
Mamld1 GCA GCAACA X: 70,162,445 (GRCm39) probably benign Het
Mapk8ip3 G A 17: 25,121,093 (GRCm39) probably null Homo
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,406,644 (GRCm39) probably benign Het
Nat8f2 T A 6: 85,844,668 (GRCm39) L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,716,464 (GRCm39) probably benign Het
Noc2l CTG CTGTTG 4: 156,324,552 (GRCm39) probably benign Het
Noc2l GGTAG GG 4: 156,325,958 (GRCm39) probably benign Homo
Noc2l GCT GCTTCT 4: 156,324,551 (GRCm39) probably benign Het
Nxpe5 C T 5: 138,228,196 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51a43 G C 7: 103,720,499 (GRCm39) probably benign Homo
Or51f2 CT CTAATTGCCTT 7: 102,526,440 (GRCm39) probably benign Homo
Or8b41 A G 9: 38,054,484 (GRCm39) I13V probably benign Homo
Or8u3-ps CAG CAGAG 2: 85,953,104 (GRCm39) probably null Homo
Osmr C CTCA 15: 6,867,187 (GRCm39) probably null Homo
Patl2 GC GCTAC 2: 121,956,625 (GRCm39) probably null Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 CTG CTGTTG 2: 121,956,617 (GRCm39) probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,006,678 (GRCm39) probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,300,557 (GRCm39) probably benign Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Pla2g4e AGGG A 2: 120,075,205 (GRCm39) probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,468,295 (GRCm39) probably benign Het
Pnma8a CCTCATGATGCACCTGCTTCAACATC CCTCATGATGCACCTGCTTCAACATCTCATGATGCACCTGCTTCAACATC 7: 16,695,350 (GRCm39) probably benign Homo
Pnma8b TGGA T 7: 16,679,931 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,370,608 (GRCm39) probably benign Het
Prss41 CACA C 17: 24,063,071 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Het
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,891,420 (GRCm39) probably benign Homo
Ptms C CTTG 6: 124,891,424 (GRCm39) probably benign Homo
Ptms TTC TTCGTC 6: 124,891,422 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rab3il1 C A 19: 10,011,115 (GRCm39) A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,659,954 (GRCm39) probably null Homo
Rtbdn TAG TAGGGGCAG 8: 85,682,790 (GRCm39) probably benign Het
Rtbdn GGC GGCAGCTGC 8: 85,682,806 (GRCm39) probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 85,682,805 (GRCm39) probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 85,682,797 (GRCm39) probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 24,164,356 (GRCm39) probably benign Het
Sbp G GCTGACAACAAAGATC 17: 24,164,363 (GRCm39) probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,384,484 (GRCm39) probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,646,820 (GRCm39) probably benign Het
Six3 GGC GGCAGC 17: 85,928,785 (GRCm39) probably benign Het
Six3 GCG GCGCCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,790 (GRCm39) probably benign Het
Six3 GGC GGCAGC 17: 85,928,791 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,793 (GRCm39) probably benign Het
Six3 CGG CGGGGG 17: 85,928,796 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 124,996,134 (GRCm39) probably benign Homo
Smarca2 CAGCAGCAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,399 (GRCm39) probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 (GRCm39) probably benign Het
Spag1 TTC TTCGTC 15: 36,197,879 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,573 (GRCm39) probably benign Het
Spata31h1 TTCA T 10: 82,121,303 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Srpk2 T C 5: 23,750,194 (GRCm39) probably null Homo
Sry AACTGCT A Y: 2,663,195 (GRCm39) probably benign Het
Sry GTG GTGTTG Y: 2,662,837 (GRCm39) probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 (GRCm39) probably benign Homo
Stard9 C CTAAGGGACTAGTAGG 2: 120,526,566 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,079 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,635,082 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,635,078 (GRCm39) probably benign Het
Tcof1 GGGTA G 18: 60,961,722 (GRCm39) probably benign Homo
Tdpoz3 A C 3: 93,733,981 (GRCm39) N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 (GRCm39) probably null Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CACA CACAACA 11: 94,105,277 (GRCm39) probably benign Het
Tob1 A AGCC 11: 94,105,304 (GRCm39) probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,887,213 (GRCm39) probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Homo
Trim63 GAGT G 4: 134,055,036 (GRCm39) probably benign Het
Tsbp1 CAG CAGAAG 17: 34,679,025 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,042 (GRCm39) probably benign Het
Tsen2 G GAGA 6: 115,537,038 (GRCm39) probably benign Het
Ttf2 TC TCCCC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,223,550 (GRCm39) probably benign Homo
Ubqlnl TGAG T 7: 103,799,042 (GRCm39) probably benign Homo
Ubtf CCT CCTACT 11: 102,197,774 (GRCm39) probably null Het
Ubtf TCC TCCACC 11: 102,197,776 (GRCm39) probably benign Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wasf3 G T 5: 146,407,060 (GRCm39) R460L probably damaging Het
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,561,039 (GRCm39) probably benign Homo
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,561,036 (GRCm39) probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 109,682,720 (GRCm39) probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 109,682,735 (GRCm39) probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 109,682,734 (GRCm39) probably benign Het
Zfp111 TCA TCAACA 7: 23,899,230 (GRCm39) probably benign Homo
Zfp112 CATGA CATGATGA 7: 23,824,832 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp282 CGG CGGGGG 6: 47,881,733 (GRCm39) probably benign Het
Zfp335 TC TCCCC 2: 164,749,404 (GRCm39) probably benign Het
Zfp335 TCC TCCGCC 2: 164,749,395 (GRCm39) probably benign Het
Zfp335 CTC CTCGTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp598 AC ACCACCGC 17: 24,899,765 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp831 TCC TCCCCC 2: 174,487,264 (GRCm39) probably benign Het
Zfp831 TC TCCGC 2: 174,487,276 (GRCm39) probably benign Het
Zfp831 CTC CTCATC 2: 174,487,269 (GRCm39) probably benign Het
Zfp93 CAGGCATAG CAG 7: 23,974,814 (GRCm39) probably benign Homo
Zscan10 TGACG TG 17: 23,828,419 (GRCm39) probably benign Homo
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4,496,836 (GRCm39) missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4,464,114 (GRCm39) missense probably benign
IGL01018:Ccdc170 APN 10 4,462,788 (GRCm39) missense probably benign
IGL01018:Ccdc170 APN 10 4,464,155 (GRCm39) missense probably benign 0.00
IGL01114:Ccdc170 APN 10 4,508,550 (GRCm39) missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4,510,966 (GRCm39) missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4,499,713 (GRCm39) missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4,491,885 (GRCm39) splice site probably null
FR4304:Ccdc170 UTSW 10 4,511,021 (GRCm39) small insertion probably benign
FR4548:Ccdc170 UTSW 10 4,511,026 (GRCm39) small insertion probably benign
FR4737:Ccdc170 UTSW 10 4,511,029 (GRCm39) small insertion probably benign
FR4976:Ccdc170 UTSW 10 4,511,029 (GRCm39) small insertion probably benign
FR4976:Ccdc170 UTSW 10 4,511,008 (GRCm39) small insertion probably benign
FR4976:Ccdc170 UTSW 10 4,511,023 (GRCm39) small insertion probably benign
R0137:Ccdc170 UTSW 10 4,496,950 (GRCm39) splice site probably benign
R0280:Ccdc170 UTSW 10 4,508,663 (GRCm39) missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4,468,939 (GRCm39) missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4,469,043 (GRCm39) missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4,484,208 (GRCm39) missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4,468,931 (GRCm39) missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4,510,920 (GRCm39) missense possibly damaging 0.60
R4494:Ccdc170 UTSW 10 4,464,128 (GRCm39) missense probably damaging 1.00
R4916:Ccdc170 UTSW 10 4,468,971 (GRCm39) missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4,511,107 (GRCm39) missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4,464,200 (GRCm39) missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4,484,188 (GRCm39) missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4,508,551 (GRCm39) nonsense probably null
R5983:Ccdc170 UTSW 10 4,470,851 (GRCm39) nonsense probably null
R6374:Ccdc170 UTSW 10 4,499,746 (GRCm39) nonsense probably null
R6645:Ccdc170 UTSW 10 4,510,974 (GRCm39) missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4,491,782 (GRCm39) missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4,496,854 (GRCm39) missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4,432,597 (GRCm39) missense unknown
R7206:Ccdc170 UTSW 10 4,464,120 (GRCm39) missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4,464,314 (GRCm39) critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4,508,512 (GRCm39) nonsense probably null
R7471:Ccdc170 UTSW 10 4,470,803 (GRCm39) missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4,496,839 (GRCm39) missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4,499,603 (GRCm39) missense probably benign 0.05
R8942:Ccdc170 UTSW 10 4,484,044 (GRCm39) missense probably benign 0.07
R9069:Ccdc170 UTSW 10 4,511,016 (GRCm39) missense possibly damaging 0.46
R9355:Ccdc170 UTSW 10 4,508,695 (GRCm39) missense probably benign 0.17
R9790:Ccdc170 UTSW 10 4,483,957 (GRCm39) critical splice acceptor site probably null
R9791:Ccdc170 UTSW 10 4,483,957 (GRCm39) critical splice acceptor site probably null
RF006:Ccdc170 UTSW 10 4,511,030 (GRCm39) small insertion probably benign
RF009:Ccdc170 UTSW 10 4,511,030 (GRCm39) small insertion probably benign
RF011:Ccdc170 UTSW 10 4,511,018 (GRCm39) small insertion probably benign
RF017:Ccdc170 UTSW 10 4,511,024 (GRCm39) small insertion probably benign
RF023:Ccdc170 UTSW 10 4,511,018 (GRCm39) small insertion probably benign
RF024:Ccdc170 UTSW 10 4,511,024 (GRCm39) small insertion probably benign
RF025:Ccdc170 UTSW 10 4,511,026 (GRCm39) small insertion probably benign
RF027:Ccdc170 UTSW 10 4,511,026 (GRCm39) small insertion probably benign
RF029:Ccdc170 UTSW 10 4,511,026 (GRCm39) small insertion probably benign
RF050:Ccdc170 UTSW 10 4,511,008 (GRCm39) small insertion probably benign
RF064:Ccdc170 UTSW 10 4,511,025 (GRCm39) small insertion probably benign
Z1177:Ccdc170 UTSW 10 4,459,884 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTATTGTTGTTGCACTTGACC -3'
(R):5'- GTCACACACTATGGCTGAATTTC -3'

Sequencing Primer
(F):5'- GTTGCACTTGACCCAGCAATG -3'
(R):5'- CACAACTGGAGAATCGTAC -3'
Posted On 2018-04-05