Incidental Mutation 'FR4737:Cdx1'
Institutional Source Beutler Lab
Gene Symbol Cdx1
Ensembl Gene ENSMUSG00000024619
Gene Namecaudal type homeobox 1
SynonymsCdx-1, Cdx
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #FR4737 ()
Quality Score217.468
Status Not validated
Chromosomal Location61018862-61036199 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCTGCT to GCTGCTTCTGCT at 61019878 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025521]
Predicted Effect probably benign
Transcript: ENSMUST00000025521
SMART Domains Protein: ENSMUSP00000025521
Gene: ENSMUSG00000024619

Pfam:Caudal_act 13 146 4.8e-31 PFAM
HOX 154 216 1.3e-25 SMART
low complexity region 217 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormalities of the basiocciptal bone, vertebrae, and ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 210 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,668,448 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4932415D10Rik TTCA T 10: 82,285,469 probably benign Homo
4932438A13Rik TTATTAT TTATTATTATTATTACTATTAT 3: 37,050,754 probably benign Het
A630001G21Rik CTGTT CT 1: 85,723,135 probably benign Homo
Abcb11 C A 2: 69,243,518 R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,896,597 probably benign Homo
Ahdc1 CT CTCGT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTACT 7: 81,077,762 probably benign Het
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,683,849 probably benign Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,281,999 probably benign Homo
Apol6 GTTT GTTTCTTT 15: 77,051,442 probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,126,787 probably null Het
AY358078 C T 14: 51,805,698 S281L unknown Homo
BC051142 CAG CAGAAG 17: 34,460,051 probably benign Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
Blm ACCTGC ACCTGCCTGC 7: 80,463,771 probably null Het
Blm T TACCA 7: 80,463,774 probably null Het
Blzf1 TTGT TT 1: 164,303,917 probably null Homo
Btnl10 A AAGG 11: 58,923,931 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,726 probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,397,540 probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCCC 10: 4,561,029 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdan1 A C 2: 120,724,971 V763G probably damaging Het
Cdk6 A G 5: 3,344,211 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCCC 6: 125,122,131 probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,669,519 probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,669,524 probably benign Het
Cluh CC CCTGAGGC 11: 74,669,533 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,189,576 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,582 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,590 probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,500,846 probably benign Het
Cul9 CTC CTCTTC 17: 46,500,858 probably benign Het
Cyth2 C A 7: 45,813,042 S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,583,699 probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,738,179 probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,182 probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,738,189 probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,635,465 probably benign Het
Dnah8 CCTCCCG C 17: 30,635,477 probably benign Homo
Dnajb5 AGGTG A 4: 42,957,126 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,455,192 probably benign Homo
Eif3a TTA TTATTATA 19: 60,775,289 probably benign Het
Fam81b TTC TTCGTC 13: 76,271,319 probably benign Het
Fbxo22 G A 9: 55,209,382 R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,284,504 probably null Het
Fcgr1 T C 3: 96,287,094 D159G probably benign Homo
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,525,778 probably benign Het
Fmn1 CC CCCCCTGC 2: 113,525,781 probably benign Het
Fmn1 CC CCTCCTTC 2: 113,525,784 probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,577,178 probably null Het
Gli3 G A 13: 15,644,357 R248H probably damaging Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,857,602 probably null Het
Gm4340 GCA GCAACA 10: 104,196,077 probably benign Het
Gm4340 AGC AGCTGC 10: 104,196,097 probably benign Het
Gm4340 AG AGCGG 10: 104,196,100 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 78,842,180 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Hrh1 T C 6: 114,481,123 I455T possibly damaging Het
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Iba57 GAAA GAAAAA 11: 59,161,505 probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Il17rd CGG CGGAGG 14: 27,082,680 probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,125,828 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,221,852 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,586,367 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,370 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,378 probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,386,197 probably benign Homo
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,389,273 probably benign Het
Krt10 TCC TCCTCCACC 11: 99,389,279 probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Homo
Krtap4-2 A ACAC 11: 99,635,013 probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,598,004 probably benign Het
Las1l AGG AGGGGG X: 95,940,821 probably benign Het
Las1l AGG AGGCGG X: 95,940,827 probably benign Het
Las1l GAG GAGCAG X: 95,940,829 probably benign Het
Lrit3 TGC TGCAGC 3: 129,788,806 probably benign Het
Lrit3 GCT GCTTCT 3: 129,788,810 probably benign Het
Lrit3 AC ACATTC 3: 129,803,913 probably null Homo
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,543,196 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mapk8ip3 G A 17: 24,902,119 probably null Homo
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,559,121 probably benign Het
Noc2l GCT GCTTCT 4: 156,240,094 probably benign Het
Noc2l CTG CTGTTG 4: 156,240,095 probably benign Het
Noc2l GGTAG GG 4: 156,241,501 probably benign Homo
Nxpe5 C T 5: 138,229,934 probably benign Het
Olfr1038-ps CAG CAGAG 2: 86,122,760 probably null Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr568 CT CTAATTGCCTT 7: 102,877,233 probably benign Homo
Olfr644 G C 7: 104,071,292 probably benign Homo
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Osmr C CTCA 15: 6,837,706 probably null Homo
Patl2 CTG CTGTTG 2: 122,126,136 probably benign Het
Patl2 GC GCTAC 2: 122,126,144 probably null Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,323,598 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Pla2g4e AGGG A 2: 120,244,724 probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,479,863 probably benign Het
Pnmal2 TGGA T 7: 16,946,006 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,462,173 probably benign Het
Prss41 CACA C 17: 23,844,097 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Het
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,914,457 probably benign Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Homo
Ptms C CTTG 6: 124,914,461 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rab3il1 C A 19: 10,033,751 A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,782,755 probably null Homo
Rtbdn TAG TAGGGGCAG 8: 84,956,161 probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 84,956,168 probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 84,956,176 probably benign Het
Rtbdn GGC GGCAGCTGC 8: 84,956,177 probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 23,945,382 probably benign Het
Sbp G GCTGACAACAAAGATC 17: 23,945,389 probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,785,312 probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,569,756 probably benign Het
Six3 GGC GGCAGC 17: 85,621,357 probably benign Het
Six3 GCG GCGCCG 17: 85,621,358 probably benign Het
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Six3 GGC GGCAGC 17: 85,621,363 probably benign Het
Six3 CGG CGGGGG 17: 85,621,365 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 125,154,214 probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 probably benign Het
Spag1 TTC TTCGTC 15: 36,197,733 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,257 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Srpk2 T C 5: 23,545,196 probably null Homo
Sry GTG GTGTTG Y: 2,662,837 probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 probably benign Homo
Sry AACTGCT A Y: 2,663,195 probably benign Het
Stard9 C CTAAGGGACTAGTAGG 2: 120,696,085 probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,658 probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,727,661 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tdpoz3 A C 3: 93,826,674 N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 A AGCC 11: 94,214,478 probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,649,756 probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Homo
Trim63 GAGT G 4: 134,327,725 probably benign Het
Tsen2 G GAGA 6: 115,560,077 probably benign Het
Ttf2 TC TCCCC 3: 100,963,160 probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,313 probably benign Homo
Ubqlnl TGAG T 7: 104,149,835 probably benign Homo
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Ubtf TCC TCCACC 11: 102,306,950 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wasf3 G T 5: 146,470,250 R460L probably damaging Het
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,323,596 probably benign Homo
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,323,599 probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 108,956,088 probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 108,956,102 probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 108,956,103 probably benign Het
Zfp111 TCA TCAACA 7: 24,199,805 probably benign Homo
Zfp112 CATGA CATGATGA 7: 24,125,407 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,904,790 probably benign Het
Zfp282 CGG CGGGGG 6: 47,904,799 probably benign Het
Zfp335 CTC CTCGTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCGCC 2: 164,907,475 probably benign Het
Zfp335 TC TCCCC 2: 164,907,484 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,680,782 probably benign Het
Zfp598 AC ACCACCGC 17: 24,680,791 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCATC 2: 174,645,476 probably benign Het
Zfp831 TC TCCGC 2: 174,645,483 probably benign Het
Zfp93 CAGGCATAG CAG 7: 24,275,389 probably benign Homo
Zscan10 TGACG TG 17: 23,609,445 probably benign Homo
Other mutations in Cdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Cdx1 UTSW 18 61020429 missense probably damaging 1.00
FR4449:Cdx1 UTSW 18 61019881 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019874 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019867 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019869 small insertion probably benign
R0218:Cdx1 UTSW 18 61020364 splice site probably benign
R0481:Cdx1 UTSW 18 61020492 missense probably damaging 1.00
R1776:Cdx1 UTSW 18 61036014 missense probably benign 0.01
R1914:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R1915:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R2094:Cdx1 UTSW 18 61035912 missense possibly damaging 0.85
R4191:Cdx1 UTSW 18 61020438 missense possibly damaging 0.88
R5671:Cdx1 UTSW 18 61019899 missense probably benign 0.01
R8145:Cdx1 UTSW 18 61019923 missense probably damaging 1.00
RF036:Cdx1 UTSW 18 61019870 small insertion probably benign
RF038:Cdx1 UTSW 18 61019870 small insertion probably benign
RF039:Cdx1 UTSW 18 61019870 small insertion probably benign
RF040:Cdx1 UTSW 18 61019870 small insertion probably benign
RF049:Cdx1 UTSW 18 61019866 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05