Incidental Mutation 'FR4976:Fsip2'
ID 511796
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
Accession Numbers

Genbank: XM_913669; MGI: 2664111
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # FR4976 ()
Quality Score 217.468
Status Not validated
Chromosome 2
Chromosomal Location 82943634-83008937 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTTTT to TTTTTGTTTT at 82984362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143764
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 221 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,668,447 probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930402H24Rik TCC TCCCCC 2: 130,770,739 probably benign Het
4930402H24Rik TCC TCCACC 2: 130,770,742 probably benign Het
4930402H24Rik C CTCG 2: 130,770,753 probably benign Het
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,229 probably benign Het
Akap12 AAA AAACAA 10: 4,353,837 probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,244,561 probably null Homo
Alg9 G GCGA 9: 50,775,431 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,272,532 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,281,998 probably benign Het
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,282,000 probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,282,004 probably null Het
Atad3a C A 4: 155,753,939 R207L probably damaging Homo
BC051142 AGC AGCGGC 17: 34,460,058 probably benign Het
BC051142 AGC AGCGGC 17: 34,460,061 probably benign Het
Blm ACCT ACCTCCCT 7: 80,463,767 probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Bmp5 GAGGAGT G 9: 75,776,375 probably benign Homo
Bpifa6 A T 2: 153,986,376 Q134L probably benign Homo
Bpifa6 A T 2: 153,986,398 R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,717 probably benign Het
Cacna1a ACC ACCTCC 8: 84,638,726 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,262 probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,397,542 probably benign Homo
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,397,795 probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,561,008 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCTC 10: 4,561,029 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,019,867 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,869 probably benign Het
Cep112 G GCTCT 11: 108,425,352 probably benign Het
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,520 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,747 probably null Het
Cntnap1 A ACCCCCC 11: 101,189,569 probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,585 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,588 probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,718,906 probably null Het
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,537,836 probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,461 probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,467 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,850 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,856 probably benign Het
Cybrd1 GAAT G 2: 71,138,511 probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,689 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,692 probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dbr1 GG GGAGGAAG 9: 99,583,702 probably benign Het
Dcaf8 C T 1: 172,172,856 H194Y probably damaging Homo
Dnajc19 AC ACGC 3: 34,057,994 probably null Het
Dthd1 GAC GACTAC 5: 62,843,024 probably benign Homo
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,080 probably benign Het
Ermn TC TCTAC 2: 58,048,088 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Homo
Fam45a T TTCA 19: 60,814,622 probably benign Homo
Fbxo38 TGCAGC TGC 18: 62,515,347 probably benign Het
Frem3 CT CTTGT 8: 80,615,241 probably benign Homo
Gabre AGGCT AGGCTGCGGCT X: 72,270,418 probably benign Homo
Gabre T TGAGGCC X: 72,270,422 probably benign Homo
Gm10800 A AC 2: 98,667,033 probably null Homo
Gm14393 T G 2: 175,061,820 N98T probably benign Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,327,323 probably benign Homo
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gm7534 TG TGCCG 4: 134,202,630 probably benign Homo
Golga5 G A 12: 102,475,660 probably null Homo
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,170 probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,172 probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 78,842,173 probably null Het
Gpatch11 AGGAA AGGAAGTGGAA 17: 78,842,180 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 117,975,808 probably benign Homo
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Igf1r C CTGGAGATGGAGA 7: 68,226,186 probably benign Het
Il17rd CGG CGGTGG 14: 27,082,677 probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,125,829 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,616,676 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,715 probably null Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,360 probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,586,362 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,373 probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,763 probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,598,004 probably benign Homo
Las1l AGG AGGGGG X: 95,940,827 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Las1l A AGGC X: 95,940,833 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 93,018,148 probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,450,572 probably benign Het
Lrit3 CATA CATAAATA 3: 129,803,910 probably benign Homo
Lrmp CACATTG CACATTGAGGACATTG 6: 145,173,785 probably benign Homo
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 GCA GCAACA X: 71,118,818 probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,736,312 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Homo
Med12l GCA GCACCA 3: 59,275,977 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,702 probably benign Het
Morf4l2 T C X: 136,733,622 K286E probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,149,350 probably benign Het
Nacad A ACCAGGG 11: 6,599,749 probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,599,756 probably benign Het
Nacad C CAGGGTA 11: 6,599,763 probably benign Het
Nars CCACTCAC CCAC 18: 64,510,445 probably benign Homo
Ndufc2 C T 7: 97,400,274 P29L probably damaging Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l CTG CTGGTG 4: 156,240,098 probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,081,356 probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,081,375 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr547 A AAACCG 7: 102,535,681 probably null Homo
Olfr585 T TTAC 7: 103,098,309 probably benign Homo
Olfr624 AG AGAGG 7: 103,670,966 probably benign Homo
Patl2 CTG CTGGTG 2: 122,126,139 probably benign Het
Patl2 GCT GCTTCT 2: 122,126,141 probably benign Het
Patl2 GC GCTTC 2: 122,126,144 probably benign Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Homo
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,805,023 probably benign Het
Pick1 TTC TTCTC 15: 79,255,946 probably null Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,635,654 probably null Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pogz GTAAT G 3: 94,874,695 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ppp2r5c G T 12: 110,540,738 probably null Homo
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prr13 CACT CACTACT 15: 102,462,171 probably benign Homo
Prr13 CTC CTCTTC 15: 102,462,176 probably benign Homo
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,489,267 probably benign Homo
Rpa1 TGCTGCC T 11: 75,318,519 probably benign Het
Rpgrip1 GGA GGATGA 14: 52,149,394 probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,149,544 probably benign Het
Rps19 AGCGG AG 7: 24,888,996 probably benign Homo
Rsf1 G GACC 7: 97,579,909 probably benign Homo
Serpina3m A G 12: 104,358,623 probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,785,316 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,423,060 probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GCG GCGTCG 17: 85,621,358 probably benign Het
Six3 CG CGGGG 17: 85,621,371 probably benign Het
Skint8 C T 4: 111,938,902 L258F probably benign Homo
Smoc2 AGTT A 17: 14,401,562 probably benign Homo
Smpx CCCCCA C X: 157,720,924 probably benign Homo
Snx1 TC TCTGC 9: 66,104,929 probably benign Homo
Snx1 C CTTT 9: 66,104,930 probably benign Homo
Sp110 CT CTAAT 1: 85,587,489 probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 probably benign Het
Spag17 AGG AGGTGG 3: 100,056,254 probably benign Het
Spag17 GGA GGACGA 3: 100,056,255 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 probably benign Homo
Stard8 AGG AGGTGG X: 99,066,513 probably benign Het
Stard8 AGG AGGTGG X: 99,066,525 probably benign Het
Stk10 CCCA C 11: 32,614,520 probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,205,699 probably benign Homo
Tbc1d5 G C 17: 50,799,931 H532Q probably benign Homo
Tbc1d5 C G 17: 50,799,943 Q528H probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmcc1 G A 6: 116,193,380 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,649,757 probably benign Homo
Trim16 GTGA GTGATGA 11: 62,820,689 probably benign Homo
Tsen2 AGG AGGCGG 6: 115,560,066 probably benign Homo
Ubtf TC TCCGC 11: 102,306,959 probably benign Het
Vmn1r124 G T 7: 21,259,936 Q228K possibly damaging Het
Vmn1r71 A C 7: 10,748,121 S147R probably benign Homo
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Homo
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,823,404 probably benign Homo
Zfp111 T G 7: 24,199,037 K383T probably damaging Homo
Zfp111 A ATCG 7: 24,199,807 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,904,790 probably benign Het
Zfp335 CTC CTCTTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCACC 2: 164,907,478 probably benign Het
Zfp459 TGA TGAGAGA 13: 67,408,274 probably null Homo
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp459 A AGTGG 13: 67,408,276 probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 probably benign Het
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,782 probably benign Het
Zfp683 AG AGGGG 4: 134,058,879 probably benign Homo
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
bubblegum UTSW 2 82992840 missense probably benign 0.16
Dao UTSW 2 82993150 missense probably damaging 0.97
engulf UTSW 2 82984776 missense probably damaging 0.98
envelope UTSW 2 82980741 missense probably benign 0.07
gladius UTSW 2 82981949 missense possibly damaging 0.68
glove UTSW 2 82978394 missense possibly damaging 0.85
Katana UTSW 2 82989516 missense probably benign 0.07
scarf UTSW 2 82986891 missense probably benign
Sock UTSW 2 82998180 missense probably benign 0.00
swaddle UTSW 2 82983428 missense possibly damaging 0.93
wrap UTSW 2 82986820 missense probably benign 0.04
Wrapper UTSW 2 82990086 missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82990852 missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3789:Fsip2 UTSW 2 82982714 missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82975353 missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4791:Fsip2 UTSW 2 82982108 missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
R7001:Fsip2 UTSW 2 82986925 missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82989343 missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82990635 missense probably benign 0.25
R7066:Fsip2 UTSW 2 82990891 missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82980734 missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82983152 missense probably benign 0.18
R7099:Fsip2 UTSW 2 82987624 missense probably benign
R7126:Fsip2 UTSW 2 82983141 missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82982741 missense probably benign 0.00
R7165:Fsip2 UTSW 2 82981197 missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82986227 nonsense probably null
R7189:Fsip2 UTSW 2 82993237 missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82989068 missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82983671 missense probably benign
R7228:Fsip2 UTSW 2 82992307 missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82982140 missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82993263 missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82979081 missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82982130 missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82980519 missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82989691 missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82989516 missense probably benign 0.07
R7335:Fsip2 UTSW 2 82983118 missense probably benign
R7343:Fsip2 UTSW 2 82979367 missense probably benign 0.07
R7346:Fsip2 UTSW 2 82998180 missense probably benign 0.00
R7389:Fsip2 UTSW 2 82988796 missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82990319 missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82985257 missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82980097 missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82951680 missense probably benign 0.30
R7538:Fsip2 UTSW 2 82988550 missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82984852 missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82993993 missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82989017 missense probably benign 0.02
R7565:Fsip2 UTSW 2 82949512 missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82975241 missense probably benign 0.12
R7641:Fsip2 UTSW 2 82986912 nonsense probably null
R7655:Fsip2 UTSW 2 82977542 missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82977542 missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82981805 missense probably benign 0.03
R7672:Fsip2 UTSW 2 82990111 missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82980908 missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82988379 missense probably benign
R7811:Fsip2 UTSW 2 82998453 missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82976700 missense probably benign 0.00
R7873:Fsip2 UTSW 2 82949512 missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82977824 missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82951021 missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82985776 missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82988449 missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82986891 missense probably benign
R8034:Fsip2 UTSW 2 82989355 missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82985978 missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82958673 missense probably benign 0.00
R8117:Fsip2 UTSW 2 82992952 missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82975797 missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82984744 missense probably benign 0.06
R8175:Fsip2 UTSW 2 82987677 missense probably benign 0.16
R8182:Fsip2 UTSW 2 82976607 missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82990464 missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82978143 missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82989343 missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82981002 missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82988380 missense probably benign 0.00
R8336:Fsip2 UTSW 2 82990755 missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82987854 missense probably benign 0.16
R8351:Fsip2 UTSW 2 82991895 missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82984593 missense probably benign
R8419:Fsip2 UTSW 2 82978619 missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82981566 missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82977086 missense probably benign 0.24
R8452:Fsip2 UTSW 2 82984593 missense probably benign
R8459:Fsip2 UTSW 2 82979678 missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82979940 missense probably benign 0.26
R8473:Fsip2 UTSW 2 82946992 missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82991527 missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82984902 missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82981109 missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82985478 missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82983109 missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82991262 missense probably benign 0.03
R8855:Fsip2 UTSW 2 82980177 missense probably benign 0.04
R8866:Fsip2 UTSW 2 82980177 missense probably benign 0.04
R8875:Fsip2 UTSW 2 82990438 missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82979180 missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82977337 missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82986640 missense probably benign 0.20
R8912:Fsip2 UTSW 2 82980594 missense probably benign
R8926:Fsip2 UTSW 2 82993583 missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82985026 missense probably benign 0.33
R9014:Fsip2 UTSW 2 82976554 missense probably benign 0.32
R9014:Fsip2 UTSW 2 82986731 missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82998201 missense probably benign 0.32
R9054:Fsip2 UTSW 2 82975836 missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82976957 missense probably benign 0.00
R9124:Fsip2 UTSW 2 82985759 missense probably benign 0.00
R9131:Fsip2 UTSW 2 82982826 missense probably benign
R9149:Fsip2 UTSW 2 82982030 missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82985230 missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82987500 missense probably benign 0.06
R9216:Fsip2 UTSW 2 82990081 missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82992718 missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82985614 missense probably benign 0.00
R9262:Fsip2 UTSW 2 82977318 missense probably benign 0.00
R9340:Fsip2 UTSW 2 82988260 missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82988403 missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82980695 missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82992412 missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82989449 missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82975563 missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82986358 missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82975788 missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82986941 missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82962718 missense probably benign
R9523:Fsip2 UTSW 2 82977628 missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82967829 missense probably benign
R9636:Fsip2 UTSW 2 82990219 missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82991640 missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82988928 missense probably benign 0.32
R9695:Fsip2 UTSW 2 82975882 missense probably benign
R9705:Fsip2 UTSW 2 82993290 missense probably benign
R9739:Fsip2 UTSW 2 82993552 missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82987897 missense probably benign 0.00
R9761:Fsip2 UTSW 2 82991650 missense probably benign 0.00
R9798:Fsip2 UTSW 2 82979881 nonsense probably null
RF003:Fsip2 UTSW 2 82991521 missense probably benign 0.02
RF005:Fsip2 UTSW 2 82992532 missense probably benign 0.04
RF008:Fsip2 UTSW 2 82977840 missense probably benign
RF028:Fsip2 UTSW 2 82994008 frame shift probably null
RF029:Fsip2 UTSW 2 82994008 frame shift probably null
RF036:Fsip2 UTSW 2 82984363 critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82994008 frame shift probably null
RF062:Fsip2 UTSW 2 82984363 critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Z1176:Fsip2 UTSW 2 82989665 missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82946960 missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82984524 missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82987203 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACCTTACAAGTAAATGCAGCATAGC -3'
(R):5'- GCATCTTGGATTTCCCATGC -3'

Sequencing Primer
(F):5'- GCAGCATAGCATCACATATTTTGAC -3'
(R):5'- GGATTTCCCATGCTTTCTCTCTG -3'
Posted On 2018-04-05