Incidental Mutation 'FR4976:Pogz'
ID 511821
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Name pogo transposable element with ZNF domain
Synonyms 9530006B08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock # FR4976 ()
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 94837567-94882326 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GTAAT to G at 94874695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
AlphaFold Q8BZH4
Predicted Effect probably benign
Transcript: ENSMUST00000042402
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107266
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107269
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107270
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125638
Predicted Effect probably benign
Transcript: ENSMUST00000140397
SMART Domains Protein: ENSMUSP00000122492
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 31 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142253
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 222 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,668,447 probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930402H24Rik TCC TCCCCC 2: 130,770,739 probably benign Het
4930402H24Rik TCC TCCACC 2: 130,770,742 probably benign Het
4930402H24Rik C CTCG 2: 130,770,753 probably benign Het
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,229 probably benign Het
Akap12 AAA AAACAA 10: 4,353,837 probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,244,561 probably null Homo
Alg9 G GCGA 9: 50,775,431 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,272,532 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,281,998 probably benign Het
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,282,000 probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,282,004 probably null Het
Atad3a C A 4: 155,753,939 R207L probably damaging Homo
BC051142 AGC AGCGGC 17: 34,460,058 probably benign Het
BC051142 AGC AGCGGC 17: 34,460,061 probably benign Het
Blm ACCT ACCTCCCT 7: 80,463,767 probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Bmp5 GAGGAGT G 9: 75,776,375 probably benign Homo
Bpifa6 A T 2: 153,986,376 Q134L probably benign Homo
Bpifa6 A T 2: 153,986,398 R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,717 probably benign Het
Cacna1a ACC ACCTCC 8: 84,638,726 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,262 probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,397,542 probably benign Homo
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,397,795 probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,561,008 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCTC 10: 4,561,029 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,019,867 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,869 probably benign Het
Cep112 G GCTCT 11: 108,425,352 probably benign Het
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,520 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,747 probably null Het
Cntnap1 A ACCCCCC 11: 101,189,569 probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,585 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,588 probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,718,906 probably null Het
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,537,836 probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,461 probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,467 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,850 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,856 probably benign Het
Cybrd1 GAAT G 2: 71,138,511 probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,689 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,692 probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dbr1 GG GGAGGAAG 9: 99,583,702 probably benign Het
Dcaf8 C T 1: 172,172,856 H194Y probably damaging Homo
Dnajc19 AC ACGC 3: 34,057,994 probably null Het
Dthd1 GAC GACTAC 5: 62,843,024 probably benign Homo
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,080 probably benign Het
Ermn TC TCTAC 2: 58,048,088 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Homo
Fam45a T TTCA 19: 60,814,622 probably benign Homo
Fbxo38 TGCAGC TGC 18: 62,515,347 probably benign Het
Frem3 CT CTTGT 8: 80,615,241 probably benign Homo
Fsip2 TTTTT TTTTTGTTTT 2: 82,984,362 probably benign Het
Fsip2 TT TTTTTCT 2: 82,984,365 probably benign Het
Gabre AGGCT AGGCTGCGGCT X: 72,270,418 probably benign Homo
Gabre T TGAGGCC X: 72,270,422 probably benign Homo
Gm10800 A AC 2: 98,667,033 probably null Homo
Gm14393 T G 2: 175,061,820 N98T probably benign Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,327,323 probably benign Homo
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gm7534 TG TGCCG 4: 134,202,630 probably benign Homo
Golga5 G A 12: 102,475,660 probably null Homo
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,170 probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,172 probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 78,842,173 probably null Het
Gpatch11 AGGAA AGGAAGTGGAA 17: 78,842,180 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 117,975,808 probably benign Homo
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Igf1r C CTGGAGATGGAGA 7: 68,226,186 probably benign Het
Il17rd CGG CGGTGG 14: 27,082,677 probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,125,829 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,616,676 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,715 probably null Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,360 probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,586,362 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,373 probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,763 probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,598,004 probably benign Homo
Las1l AGG AGGGGG X: 95,940,827 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Las1l A AGGC X: 95,940,833 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 93,018,148 probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,450,572 probably benign Het
Lrit3 CATA CATAAATA 3: 129,803,910 probably benign Homo
Lrmp CACATTG CACATTGAGGACATTG 6: 145,173,785 probably benign Homo
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 GCA GCAACA X: 71,118,818 probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,736,312 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Homo
Med12l GCA GCACCA 3: 59,275,977 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,702 probably benign Het
Morf4l2 T C X: 136,733,622 K286E probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,149,350 probably benign Het
Nacad A ACCAGGG 11: 6,599,749 probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,599,756 probably benign Het
Nacad C CAGGGTA 11: 6,599,763 probably benign Het
Nars CCACTCAC CCAC 18: 64,510,445 probably benign Homo
Ndufc2 C T 7: 97,400,274 P29L probably damaging Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l CTG CTGGTG 4: 156,240,098 probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,081,356 probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,081,375 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr547 A AAACCG 7: 102,535,681 probably null Homo
Olfr585 T TTAC 7: 103,098,309 probably benign Homo
Olfr624 AG AGAGG 7: 103,670,966 probably benign Homo
Patl2 CTG CTGGTG 2: 122,126,139 probably benign Het
Patl2 GCT GCTTCT 2: 122,126,141 probably benign Het
Patl2 GC GCTTC 2: 122,126,144 probably benign Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Homo
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,805,023 probably benign Het
Pick1 TTC TTCTC 15: 79,255,946 probably null Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,635,654 probably null Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ppp2r5c G T 12: 110,540,738 probably null Homo
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prr13 CACT CACTACT 15: 102,462,171 probably benign Homo
Prr13 CTC CTCTTC 15: 102,462,176 probably benign Homo
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,489,267 probably benign Homo
Rpa1 TGCTGCC T 11: 75,318,519 probably benign Het
Rpgrip1 GGA GGATGA 14: 52,149,394 probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,149,544 probably benign Het
Rps19 AGCGG AG 7: 24,888,996 probably benign Homo
Rsf1 G GACC 7: 97,579,909 probably benign Homo
Serpina3m A G 12: 104,358,623 probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,785,316 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,423,060 probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GCG GCGTCG 17: 85,621,358 probably benign Het
Six3 CG CGGGG 17: 85,621,371 probably benign Het
Skint8 C T 4: 111,938,902 L258F probably benign Homo
Smoc2 AGTT A 17: 14,401,562 probably benign Homo
Smpx CCCCCA C X: 157,720,924 probably benign Homo
Snx1 TC TCTGC 9: 66,104,929 probably benign Homo
Snx1 C CTTT 9: 66,104,930 probably benign Homo
Sp110 CT CTAAT 1: 85,587,489 probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 probably benign Het
Spag17 AGG AGGTGG 3: 100,056,254 probably benign Het
Spag17 GGA GGACGA 3: 100,056,255 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 probably benign Homo
Stard8 AGG AGGTGG X: 99,066,513 probably benign Het
Stard8 AGG AGGTGG X: 99,066,525 probably benign Het
Stk10 CCCA C 11: 32,614,520 probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,205,699 probably benign Homo
Tbc1d5 G C 17: 50,799,931 H532Q probably benign Homo
Tbc1d5 C G 17: 50,799,943 Q528H probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmcc1 G A 6: 116,193,380 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,649,757 probably benign Homo
Trim16 GTGA GTGATGA 11: 62,820,689 probably benign Homo
Tsen2 AGG AGGCGG 6: 115,560,066 probably benign Homo
Ubtf TC TCCGC 11: 102,306,959 probably benign Het
Vmn1r124 G T 7: 21,259,936 Q228K possibly damaging Het
Vmn1r71 A C 7: 10,748,121 S147R probably benign Homo
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Homo
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,823,404 probably benign Homo
Zfp111 T G 7: 24,199,037 K383T probably damaging Homo
Zfp111 A ATCG 7: 24,199,807 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,904,790 probably benign Het
Zfp335 CTC CTCTTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCACC 2: 164,907,478 probably benign Het
Zfp459 TGA TGAGAGA 13: 67,408,274 probably null Homo
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp459 A AGTGG 13: 67,408,276 probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 probably benign Het
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,782 probably benign Het
Zfp683 AG AGGGG 4: 134,058,879 probably benign Homo
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
PIT4382001:Pogz UTSW 3 94879796 missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94872370 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1670:Pogz UTSW 3 94878849 missense probably benign 0.21
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1855:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R6104:Pogz UTSW 3 94880031 missense probably benign 0.09
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
R7632:Pogz UTSW 3 94856206 splice site probably null
R7788:Pogz UTSW 3 94875233 missense probably damaging 0.99
R7810:Pogz UTSW 3 94870107 missense probably benign 0.00
R8396:Pogz UTSW 3 94878750 missense probably benign 0.00
R8681:Pogz UTSW 3 94860923 missense probably damaging 1.00
R8981:Pogz UTSW 3 94878915 missense probably damaging 0.96
R8982:Pogz UTSW 3 94879568 missense probably damaging 1.00
R9024:Pogz UTSW 3 94878232 missense probably damaging 1.00
R9056:Pogz UTSW 3 94880219 missense probably benign 0.02
R9316:Pogz UTSW 3 94877348 missense probably damaging 1.00
RF014:Pogz UTSW 3 94878247 missense possibly damaging 0.77
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTACAGATGTGATCTTAAGAG -3'
(R):5'- AGACAGCTCTTGGTATGCCAG -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCAAGGCCAGCC -3'
(R):5'- TCTTGGTATGCCAGGAGTCCC -3'
Posted On 2018-04-05