Incidental Mutation 'FR4976:Phc1'
ID 511850
Institutional Source Beutler Lab
Gene Symbol Phc1
Ensembl Gene ENSMUSG00000040669
Gene Name polyhomeotic 1
Synonyms rae28, Mph1, Rae-28, Edr1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # FR4976 ()
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 122294690-122317520 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) TG to TGCTGCGG at 122300559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000159252] [ENSMUST00000160163] [ENSMUST00000160696] [ENSMUST00000161054] [ENSMUST00000161739] [ENSMUST00000160843]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079560
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081849
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112600
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159252
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160696
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161054
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161739
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161877
SMART Domains Protein: ENSMUSP00000123854
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161290
SMART Domains Protein: ENSMUSP00000125110
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160843
SMART Domains Protein: ENSMUSP00000125030
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality, posterior skeletal transformations and defects in neural crest derived tissues, including ocular abnormalities, cleft palate, parathyroid and thymic hypoplasia and cardiac anomalies. Hematopoiesis is impaired in fetal livers. [provided by MGI curators]
Allele List at MGI

All alleles(147) : Targeted, knock-out(1) Gene trapped(146)

Other mutations in this stock
Total: 222 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,634,881 (GRCm39) probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,257 (GRCm39) probably benign Het
Akap12 AAA AAACAA 10: 4,303,837 (GRCm39) probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,062,425 (GRCm39) probably null Homo
Alg9 G GCGA 9: 50,686,731 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,162,544 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,415,057 (GRCm39) probably null Het
Atad3a C A 4: 155,838,396 (GRCm39) R207L probably damaging Homo
Blm ACCT ACCTCCCT 7: 80,113,515 (GRCm39) probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bmp5 GAGGAGT G 9: 75,683,657 (GRCm39) probably benign Homo
Bpifa6 A T 2: 153,828,296 (GRCm39) Q134L probably benign Homo
Bpifa6 A T 2: 153,828,318 (GRCm39) R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1a ACC ACCTCC 8: 85,365,355 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,701 (GRCm39) probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Homo
Catsper2 C CTTTTACTTTTTT 2: 121,228,023 (GRCm39) probably benign Homo
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,228,276 (GRCm39) probably benign Het
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,511,008 (GRCm39) probably benign Het
Ccdc170 AC ACCTC 10: 4,511,029 (GRCm39) probably benign Het
Ccdc170 ACC ACCGCC 10: 4,511,023 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,152,939 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,941 (GRCm39) probably benign Het
Cep112 G GCTCT 11: 108,316,178 (GRCm39) probably benign Het
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,346 (GRCm39) probably benign Het
Cnpy3 CCT CCTACT 17: 47,047,673 (GRCm39) probably null Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,411 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,414 (GRCm39) probably benign Het
Cntnap1 A ACCCCCC 11: 101,080,395 (GRCm39) probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,696,627 (GRCm39) probably null Het
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm AGTG AGTGGGTG 13: 61,685,650 (GRCm39) probably null Homo
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,466 (GRCm39) probably benign Het
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,460 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,776 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,782 (GRCm39) probably benign Het
Cul9 CTTC CTTCTTC 17: 46,811,774 (GRCm39) probably benign Het
Cybrd1 GAAT G 2: 70,968,855 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,742 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,745 (GRCm39) probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dbr1 GG GGAGGAAG 9: 99,465,755 (GRCm39) probably benign Het
Dcaf8 C T 1: 172,000,423 (GRCm39) H194Y probably damaging Homo
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Homo
Dennd10 T TTCA 19: 60,803,060 (GRCm39) probably benign Homo
Dnaaf9 C CTCG 2: 130,612,673 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,659 (GRCm39) probably benign Het
Dnaaf9 TCC TCCACC 2: 130,612,662 (GRCm39) probably benign Het
Dnajc19 AC ACGC 3: 34,112,143 (GRCm39) probably null Het
Dthd1 GAC GACTAC 5: 63,000,367 (GRCm39) probably benign Homo
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn CTT CTTGTT 2: 57,938,092 (GRCm39) probably benign Het
Ermn TC TCTAC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo38 TGCAGC TGC 18: 62,648,418 (GRCm39) probably benign Het
Frem3 CT CTTGT 8: 81,341,870 (GRCm39) probably benign Homo
Fsip2 TT TTTTTCT 2: 82,814,709 (GRCm39) probably benign Het
Fsip2 TTTTT TTTTTGTTTT 2: 82,814,706 (GRCm39) probably benign Het
Gabre T TGAGGCC X: 71,314,028 (GRCm39) probably benign Homo
Gabre AGGCT AGGCTGCGGCT X: 71,314,024 (GRCm39) probably benign Homo
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Homo
Gm14393 T G 2: 174,903,613 (GRCm39) N98T probably benign Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,255,061 (GRCm39) probably benign Homo
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Golga5 G A 12: 102,441,919 (GRCm39) probably null Homo
Gpatch11 AGGAA AGGAAGTGGAA 17: 79,149,609 (GRCm39) probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 79,149,602 (GRCm39) probably null Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,601 (GRCm39) probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,599 (GRCm39) probably benign Het
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 118,112,344 (GRCm39) probably benign Homo
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igf1r C CTGGAGATGGAGA 7: 67,875,934 (GRCm39) probably benign Het
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGTGG 14: 26,804,634 (GRCm39) probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,179,978 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,510,469 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGGACATTG 6: 145,119,511 (GRCm39) probably benign Homo
Isg20l2 AAG AAGTAG 3: 87,839,022 (GRCm39) probably null Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,798 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,785 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,285,787 (GRCm39) probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,520,761 (GRCm39) probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,488,830 (GRCm39) probably benign Homo
Las1l AGG AGGGGG X: 94,984,433 (GRCm39) probably benign Het
Las1l A AGGC X: 94,984,439 (GRCm39) probably benign Het
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,357,854 (GRCm39) probably benign Het
Lrit3 CATA CATAAATA 3: 129,597,559 (GRCm39) probably benign Homo
Mamld1 GCA GCAACA X: 70,162,424 (GRCm39) probably benign Het
Mamld1 GCAACA GCAACAACA X: 70,162,418 (GRCm39) probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,872,820 (GRCm39) probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,875,755 (GRCm39) probably null Homo
Med12l GCA GCACCA 3: 59,183,398 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,568 (GRCm39) probably benign Het
Morf4l2 T C X: 135,634,371 (GRCm39) K286E probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,067,587 (GRCm39) probably benign Het
Nacad C CAGGGTA 11: 6,549,763 (GRCm39) probably benign Het
Nacad A ACCAGGG 11: 6,549,749 (GRCm39) probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,549,756 (GRCm39) probably benign Het
Nars1 CCACTCAC CCAC 18: 64,643,516 (GRCm39) probably benign Homo
Ndufc2 C T 7: 97,049,481 (GRCm39) P29L probably damaging Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l CTG CTGGTG 4: 156,324,555 (GRCm39) probably benign Het
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Nolc1 AGC AGCAGCAGCGGC 19: 46,069,814 (GRCm39) probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51f1e T TTAC 7: 102,747,516 (GRCm39) probably benign Homo
Or51v8 AG AGAGG 7: 103,320,173 (GRCm39) probably benign Homo
Or52b4 A AAACCG 7: 102,184,888 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Patl2 GCT GCTTCT 2: 121,956,622 (GRCm39) probably benign Het
Patl2 CTG CTGGTG 2: 121,956,620 (GRCm39) probably benign Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 GC GCTTC 2: 121,956,625 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Homo
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,844,104 (GRCm39) probably benign Het
Pick1 TTC TTCTC 15: 79,140,146 (GRCm39) probably null Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,612,652 (GRCm39) probably null Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pogz GTAAT G 3: 94,782,006 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ppp2r5c G T 12: 110,507,172 (GRCm39) probably null Homo
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prr13 CTC CTCTTC 15: 102,370,611 (GRCm39) probably benign Homo
Prr13 CACT CACTACT 15: 102,370,606 (GRCm39) probably benign Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Homo
Rpa1 TGCTGCC T 11: 75,209,345 (GRCm39) probably benign Het
Rpgrip1 GGA GGATGA 14: 52,386,851 (GRCm39) probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,387,001 (GRCm39) probably benign Het
Rps19 AGCGG AG 7: 24,588,421 (GRCm39) probably benign Homo
Rsf1 G GACC 7: 97,229,116 (GRCm39) probably benign Homo
Serpina3m A G 12: 104,324,882 (GRCm39) probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,384,488 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,373,060 (GRCm39) probably benign Homo
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CG CGGGG 17: 85,928,799 (GRCm39) probably benign Het
Skint8 C T 4: 111,796,099 (GRCm39) L258F probably benign Homo
Smoc2 AGTT A 17: 14,621,824 (GRCm39) probably benign Homo
Smpx CCCCCA C X: 156,503,920 (GRCm39) probably benign Homo
Snx1 C CTTT 9: 66,012,212 (GRCm39) probably benign Homo
Snx1 TC TCTGC 9: 66,012,211 (GRCm39) probably benign Homo
Sp110 CT CTAAT 1: 85,515,210 (GRCm39) probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 (GRCm39) probably benign Het
Spag17 GGA GGACGA 3: 99,963,571 (GRCm39) probably benign Het
Spag17 AGG AGGTGG 3: 99,963,570 (GRCm39) probably benign Het
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 (GRCm39) probably benign Homo
Stard8 AGG AGGTGG X: 98,110,119 (GRCm39) probably benign Het
Stard8 AGG AGGTGG X: 98,110,131 (GRCm39) probably benign Het
Stk10 CCCA C 11: 32,564,520 (GRCm39) probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,424,673 (GRCm39) probably benign Homo
Tbc1d5 G C 17: 51,106,959 (GRCm39) H532Q probably benign Homo
Tbc1d5 C G 17: 51,106,971 (GRCm39) Q528H probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tmcc1 G A 6: 116,170,341 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,887,214 (GRCm39) probably benign Homo
Trim16 GTGA GTGATGA 11: 62,711,515 (GRCm39) probably benign Homo
Tsbp1 AGC AGCGGC 17: 34,679,032 (GRCm39) probably benign Het
Tsbp1 AGC AGCGGC 17: 34,679,035 (GRCm39) probably benign Het
Tsen2 AGG AGGCGG 6: 115,537,027 (GRCm39) probably benign Homo
Ubtf TC TCCGC 11: 102,197,785 (GRCm39) probably benign Het
Vmn1r124 G T 7: 20,993,861 (GRCm39) Q228K possibly damaging Het
Vmn1r71 A C 7: 10,482,048 (GRCm39) S147R probably benign Homo
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Homo
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,862,564 (GRCm39) probably benign Homo
Zfp111 T G 7: 23,898,462 (GRCm39) K383T probably damaging Homo
Zfp111 A ATCG 7: 23,899,232 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TCC TCCACC 2: 164,749,398 (GRCm39) probably benign Het
Zfp335 CTC CTCTTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp459 A AGTGG 13: 67,556,395 (GRCm39) probably null Homo
Zfp459 TGA TGAGAGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 (GRCm39) probably benign Het
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp683 AG AGGGG 4: 133,786,190 (GRCm39) probably benign Homo
Zpld2 TG TGCCG 4: 133,929,941 (GRCm39) probably benign Homo
Other mutations in Phc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Phc1 APN 6 122,299,958 (GRCm39) splice site probably benign
IGL01354:Phc1 APN 6 122,311,042 (GRCm39) missense probably damaging 1.00
IGL01786:Phc1 APN 6 122,296,479 (GRCm39) missense possibly damaging 0.82
IGL02110:Phc1 APN 6 122,298,994 (GRCm39) missense possibly damaging 0.91
IGL02479:Phc1 APN 6 122,300,676 (GRCm39) unclassified probably benign
IGL02861:Phc1 APN 6 122,300,748 (GRCm39) unclassified probably benign
IGL03106:Phc1 APN 6 122,300,428 (GRCm39) unclassified probably benign
3-1:Phc1 UTSW 6 122,315,423 (GRCm39) intron probably benign
FR4737:Phc1 UTSW 6 122,300,557 (GRCm39) small insertion probably benign
R0452:Phc1 UTSW 6 122,299,995 (GRCm39) missense probably damaging 1.00
R1146:Phc1 UTSW 6 122,300,416 (GRCm39) unclassified probably benign
R1146:Phc1 UTSW 6 122,300,416 (GRCm39) unclassified probably benign
R1301:Phc1 UTSW 6 122,302,833 (GRCm39) missense probably benign 0.03
R1738:Phc1 UTSW 6 122,295,525 (GRCm39) missense probably damaging 1.00
R2056:Phc1 UTSW 6 122,310,299 (GRCm39) missense probably damaging 0.99
R2164:Phc1 UTSW 6 122,299,296 (GRCm39) missense possibly damaging 0.82
R2183:Phc1 UTSW 6 122,300,284 (GRCm39) missense probably damaging 1.00
R2424:Phc1 UTSW 6 122,297,002 (GRCm39) missense probably damaging 0.98
R4378:Phc1 UTSW 6 122,311,966 (GRCm39) missense possibly damaging 0.66
R4648:Phc1 UTSW 6 122,298,872 (GRCm39) missense possibly damaging 0.95
R4831:Phc1 UTSW 6 122,313,964 (GRCm39) start gained probably benign
R5244:Phc1 UTSW 6 122,298,938 (GRCm39) missense probably damaging 1.00
R5475:Phc1 UTSW 6 122,311,051 (GRCm39) missense possibly damaging 0.95
R6491:Phc1 UTSW 6 122,311,923 (GRCm39)
R6701:Phc1 UTSW 6 122,302,733 (GRCm39) missense probably damaging 0.96
R6733:Phc1 UTSW 6 122,313,845 (GRCm39) missense possibly damaging 0.77
R7022:Phc1 UTSW 6 122,311,990 (GRCm39) missense probably damaging 0.98
R7383:Phc1 UTSW 6 122,300,317 (GRCm39) missense unknown
R7707:Phc1 UTSW 6 122,300,739 (GRCm39) missense unknown
R7825:Phc1 UTSW 6 122,299,340 (GRCm39) missense probably benign 0.26
R7846:Phc1 UTSW 6 122,310,329 (GRCm39) missense probably damaging 1.00
R8314:Phc1 UTSW 6 122,297,937 (GRCm39) missense unknown
R8346:Phc1 UTSW 6 122,302,774 (GRCm39) missense probably damaging 0.98
R8534:Phc1 UTSW 6 122,315,539 (GRCm39) intron probably benign
RF036:Phc1 UTSW 6 122,300,539 (GRCm39) small insertion probably benign
RF041:Phc1 UTSW 6 122,300,559 (GRCm39) small insertion probably benign
RF044:Phc1 UTSW 6 122,300,559 (GRCm39) small insertion probably benign
RF064:Phc1 UTSW 6 122,300,539 (GRCm39) small insertion probably benign
X0024:Phc1 UTSW 6 122,300,588 (GRCm39) small deletion probably benign
X0026:Phc1 UTSW 6 122,296,497 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGATAGGCGCTACAGGAGG -3'
(R):5'- CACTGATTCAGCAACAGCAG -3'

Sequencing Primer
(F):5'- CGCTACAGGAGGTTTGGAC -3'
(R):5'- TGATTCAGCAACAGCAGCAGATC -3'
Posted On 2018-04-05