Incidental Mutation 'FR4976:Cfap46'
ID 511877
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik, Ttc40
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4976 ()
Quality Score 109.973
Status Not validated
Chromosome 7
Chromosomal Location 139180867-139263733 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) CCTTCT to CCTTCTTCT at 139218846 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
AlphaFold E9Q2C0
Predicted Effect probably benign
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 222 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,634,881 (GRCm39) probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,257 (GRCm39) probably benign Het
Akap12 AAA AAACAA 10: 4,303,837 (GRCm39) probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,062,425 (GRCm39) probably null Homo
Alg9 G GCGA 9: 50,686,731 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,162,544 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,415,057 (GRCm39) probably null Het
Atad3a C A 4: 155,838,396 (GRCm39) R207L probably damaging Homo
Blm ACCT ACCTCCCT 7: 80,113,515 (GRCm39) probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bmp5 GAGGAGT G 9: 75,683,657 (GRCm39) probably benign Homo
Bpifa6 A T 2: 153,828,296 (GRCm39) Q134L probably benign Homo
Bpifa6 A T 2: 153,828,318 (GRCm39) R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1a ACC ACCTCC 8: 85,365,355 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,701 (GRCm39) probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,228,023 (GRCm39) probably benign Homo
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,228,276 (GRCm39) probably benign Het
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Homo
Ccdc170 ACC ACCGCC 10: 4,511,023 (GRCm39) probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,511,008 (GRCm39) probably benign Het
Ccdc170 AC ACCTC 10: 4,511,029 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,152,939 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,941 (GRCm39) probably benign Het
Cep112 G GCTCT 11: 108,316,178 (GRCm39) probably benign Het
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,346 (GRCm39) probably benign Het
Cnpy3 CCT CCTACT 17: 47,047,673 (GRCm39) probably null Het
Cntnap1 A ACCCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,414 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,411 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,080,398 (GRCm39) probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,696,627 (GRCm39) probably null Het
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm AGTG AGTGGGTG 13: 61,685,650 (GRCm39) probably null Homo
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,466 (GRCm39) probably benign Het
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,460 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,776 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,782 (GRCm39) probably benign Het
Cul9 CTTC CTTCTTC 17: 46,811,774 (GRCm39) probably benign Het
Cybrd1 GAAT G 2: 70,968,855 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,742 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,745 (GRCm39) probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dbr1 GG GGAGGAAG 9: 99,465,755 (GRCm39) probably benign Het
Dcaf8 C T 1: 172,000,423 (GRCm39) H194Y probably damaging Homo
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Homo
Dennd10 T TTCA 19: 60,803,060 (GRCm39) probably benign Homo
Dnaaf9 C CTCG 2: 130,612,673 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,659 (GRCm39) probably benign Het
Dnaaf9 TCC TCCACC 2: 130,612,662 (GRCm39) probably benign Het
Dnajc19 AC ACGC 3: 34,112,143 (GRCm39) probably null Het
Dthd1 GAC GACTAC 5: 63,000,367 (GRCm39) probably benign Homo
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TC TCTAC 2: 57,938,100 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,092 (GRCm39) probably benign Het
Fbxo38 TGCAGC TGC 18: 62,648,418 (GRCm39) probably benign Het
Frem3 CT CTTGT 8: 81,341,870 (GRCm39) probably benign Homo
Fsip2 TT TTTTTCT 2: 82,814,709 (GRCm39) probably benign Het
Fsip2 TTTTT TTTTTGTTTT 2: 82,814,706 (GRCm39) probably benign Het
Gabre T TGAGGCC X: 71,314,028 (GRCm39) probably benign Homo
Gabre AGGCT AGGCTGCGGCT X: 71,314,024 (GRCm39) probably benign Homo
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Homo
Gm14393 T G 2: 174,903,613 (GRCm39) N98T probably benign Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,255,061 (GRCm39) probably benign Homo
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Golga5 G A 12: 102,441,919 (GRCm39) probably null Homo
Gpatch11 AGGAA AGGAAGTGGAA 17: 79,149,609 (GRCm39) probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 79,149,602 (GRCm39) probably null Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,601 (GRCm39) probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,599 (GRCm39) probably benign Het
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 118,112,344 (GRCm39) probably benign Homo
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igf1r C CTGGAGATGGAGA 7: 67,875,934 (GRCm39) probably benign Het
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGTGG 14: 26,804,634 (GRCm39) probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,179,978 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,510,469 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGGACATTG 6: 145,119,511 (GRCm39) probably benign Homo
Isg20l2 AAG AAGTAG 3: 87,839,022 (GRCm39) probably null Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,798 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,785 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,285,787 (GRCm39) probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,520,761 (GRCm39) probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,488,830 (GRCm39) probably benign Homo
Las1l A AGGC X: 94,984,439 (GRCm39) probably benign Het
Las1l AGG AGGGGG X: 94,984,433 (GRCm39) probably benign Het
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,357,854 (GRCm39) probably benign Het
Lrit3 CATA CATAAATA 3: 129,597,559 (GRCm39) probably benign Homo
Mamld1 GCA GCAACA X: 70,162,424 (GRCm39) probably benign Het
Mamld1 GCAACA GCAACAACA X: 70,162,418 (GRCm39) probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,872,820 (GRCm39) probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,875,755 (GRCm39) probably null Homo
Med12l GCA GCACCA 3: 59,183,398 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,568 (GRCm39) probably benign Het
Morf4l2 T C X: 135,634,371 (GRCm39) K286E probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,067,587 (GRCm39) probably benign Het
Nacad C CAGGGTA 11: 6,549,763 (GRCm39) probably benign Het
Nacad A ACCAGGG 11: 6,549,749 (GRCm39) probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,549,756 (GRCm39) probably benign Het
Nars1 CCACTCAC CCAC 18: 64,643,516 (GRCm39) probably benign Homo
Ndufc2 C T 7: 97,049,481 (GRCm39) P29L probably damaging Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l CTG CTGGTG 4: 156,324,555 (GRCm39) probably benign Het
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Nolc1 AGC AGCAGCAGCGGC 19: 46,069,814 (GRCm39) probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51f1e T TTAC 7: 102,747,516 (GRCm39) probably benign Homo
Or51v8 AG AGAGG 7: 103,320,173 (GRCm39) probably benign Homo
Or52b4 A AAACCG 7: 102,184,888 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Patl2 GCT GCTTCT 2: 121,956,622 (GRCm39) probably benign Het
Patl2 CTG CTGGTG 2: 121,956,620 (GRCm39) probably benign Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 GC GCTTC 2: 121,956,625 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Homo
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,844,104 (GRCm39) probably benign Het
Pick1 TTC TTCTC 15: 79,140,146 (GRCm39) probably null Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,612,652 (GRCm39) probably null Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pogz GTAAT G 3: 94,782,006 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ppp2r5c G T 12: 110,507,172 (GRCm39) probably null Homo
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prr13 CTC CTCTTC 15: 102,370,611 (GRCm39) probably benign Homo
Prr13 CACT CACTACT 15: 102,370,606 (GRCm39) probably benign Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Homo
Rpa1 TGCTGCC T 11: 75,209,345 (GRCm39) probably benign Het
Rpgrip1 GGA GGATGA 14: 52,386,851 (GRCm39) probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,387,001 (GRCm39) probably benign Het
Rps19 AGCGG AG 7: 24,588,421 (GRCm39) probably benign Homo
Rsf1 G GACC 7: 97,229,116 (GRCm39) probably benign Homo
Serpina3m A G 12: 104,324,882 (GRCm39) probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,384,488 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,373,060 (GRCm39) probably benign Homo
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CG CGGGG 17: 85,928,799 (GRCm39) probably benign Het
Skint8 C T 4: 111,796,099 (GRCm39) L258F probably benign Homo
Smoc2 AGTT A 17: 14,621,824 (GRCm39) probably benign Homo
Smpx CCCCCA C X: 156,503,920 (GRCm39) probably benign Homo
Snx1 C CTTT 9: 66,012,212 (GRCm39) probably benign Homo
Snx1 TC TCTGC 9: 66,012,211 (GRCm39) probably benign Homo
Sp110 CT CTAAT 1: 85,515,210 (GRCm39) probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 (GRCm39) probably benign Het
Spag17 GGA GGACGA 3: 99,963,571 (GRCm39) probably benign Het
Spag17 AGG AGGTGG 3: 99,963,570 (GRCm39) probably benign Het
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 (GRCm39) probably benign Homo
Stard8 AGG AGGTGG X: 98,110,119 (GRCm39) probably benign Het
Stard8 AGG AGGTGG X: 98,110,131 (GRCm39) probably benign Het
Stk10 CCCA C 11: 32,564,520 (GRCm39) probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,424,673 (GRCm39) probably benign Homo
Tbc1d5 G C 17: 51,106,959 (GRCm39) H532Q probably benign Homo
Tbc1d5 C G 17: 51,106,971 (GRCm39) Q528H probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tmcc1 G A 6: 116,170,341 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,887,214 (GRCm39) probably benign Homo
Trim16 GTGA GTGATGA 11: 62,711,515 (GRCm39) probably benign Homo
Tsbp1 AGC AGCGGC 17: 34,679,032 (GRCm39) probably benign Het
Tsbp1 AGC AGCGGC 17: 34,679,035 (GRCm39) probably benign Het
Tsen2 AGG AGGCGG 6: 115,537,027 (GRCm39) probably benign Homo
Ubtf TC TCCGC 11: 102,197,785 (GRCm39) probably benign Het
Vmn1r124 G T 7: 20,993,861 (GRCm39) Q228K possibly damaging Het
Vmn1r71 A C 7: 10,482,048 (GRCm39) S147R probably benign Homo
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Homo
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,862,564 (GRCm39) probably benign Homo
Zfp111 T G 7: 23,898,462 (GRCm39) K383T probably damaging Homo
Zfp111 A ATCG 7: 23,899,232 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TCC TCCACC 2: 164,749,398 (GRCm39) probably benign Het
Zfp335 CTC CTCTTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp459 A AGTGG 13: 67,556,395 (GRCm39) probably null Homo
Zfp459 TGA TGAGAGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 (GRCm39) probably benign Het
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp683 AG AGGGG 4: 133,786,190 (GRCm39) probably benign Homo
Zpld2 TG TGCCG 4: 133,929,941 (GRCm39) probably benign Homo
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139,194,359 (GRCm39) missense probably benign 0.06
IGL00505:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139,246,895 (GRCm39) missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139,186,523 (GRCm39) missense unknown
IGL02171:Cfap46 APN 7 139,246,972 (GRCm39) missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139,262,425 (GRCm39) missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139,194,386 (GRCm39) missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139,187,117 (GRCm39) missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139,183,168 (GRCm39) missense unknown
IGL03329:Cfap46 APN 7 139,181,081 (GRCm39) missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139,218,711 (GRCm39) utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139,225,467 (GRCm39) missense
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139,234,482 (GRCm39) missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139,231,449 (GRCm39) splice site probably benign
R0650:Cfap46 UTSW 7 139,185,571 (GRCm39) missense unknown
R0675:Cfap46 UTSW 7 139,255,950 (GRCm39) missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139,234,586 (GRCm39) missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139,235,757 (GRCm39) missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139,222,513 (GRCm39) missense probably benign 0.42
R1251:Cfap46 UTSW 7 139,181,181 (GRCm39) missense probably benign 0.40
R1257:Cfap46 UTSW 7 139,234,545 (GRCm39) nonsense probably null
R1538:Cfap46 UTSW 7 139,262,924 (GRCm39) missense probably null 1.00
R1618:Cfap46 UTSW 7 139,232,726 (GRCm39) missense probably benign 0.04
R1655:Cfap46 UTSW 7 139,222,436 (GRCm39) nonsense probably null
R1824:Cfap46 UTSW 7 139,219,518 (GRCm39) missense probably benign 0.12
R1830:Cfap46 UTSW 7 139,220,323 (GRCm39) missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139,233,324 (GRCm39) missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139,263,386 (GRCm39) missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139,259,819 (GRCm39) missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139,246,957 (GRCm39) missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139,263,677 (GRCm39) missense probably benign 0.03
R2354:Cfap46 UTSW 7 139,240,962 (GRCm39) missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139,197,506 (GRCm39) missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139,219,515 (GRCm39) missense probably benign 0.06
R3949:Cfap46 UTSW 7 139,258,467 (GRCm39) missense probably benign 0.12
R4239:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139,232,589 (GRCm39) missense probably benign 0.27
R4365:Cfap46 UTSW 7 139,230,868 (GRCm39) missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139,239,998 (GRCm39) intron probably benign
R4595:Cfap46 UTSW 7 139,232,320 (GRCm39) missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4627:Cfap46 UTSW 7 139,237,197 (GRCm39) missense probably damaging 0.99
R4628:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139,207,372 (GRCm39) missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139,259,239 (GRCm39) critical splice donor site probably null
R4771:Cfap46 UTSW 7 139,210,524 (GRCm39) missense probably null
R4779:Cfap46 UTSW 7 139,239,731 (GRCm39) intron probably benign
R4812:Cfap46 UTSW 7 139,215,916 (GRCm39) missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139,187,104 (GRCm39) critical splice donor site probably null
R5014:Cfap46 UTSW 7 139,207,291 (GRCm39) missense probably benign 0.12
R5033:Cfap46 UTSW 7 139,183,776 (GRCm39) missense probably benign 0.00
R5055:Cfap46 UTSW 7 139,241,106 (GRCm39) missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139,258,430 (GRCm39) missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139,193,423 (GRCm39) critical splice donor site probably null
R5366:Cfap46 UTSW 7 139,230,802 (GRCm39) missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139,207,389 (GRCm39) missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139,212,097 (GRCm39) splice site probably null
R5642:Cfap46 UTSW 7 139,258,493 (GRCm39) missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139,218,269 (GRCm39) missense probably benign 0.01
R5691:Cfap46 UTSW 7 139,186,616 (GRCm39) missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139,191,947 (GRCm39) missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139,230,858 (GRCm39) missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139,231,511 (GRCm39) missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139,236,496 (GRCm39) missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139,241,001 (GRCm39) missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139,260,747 (GRCm39) missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139,194,321 (GRCm39) critical splice donor site probably null
R6736:Cfap46 UTSW 7 139,199,887 (GRCm39) missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139,232,356 (GRCm39) missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139,222,477 (GRCm39) utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139,232,414 (GRCm39) missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139,234,477 (GRCm39) critical splice donor site probably null
R6912:Cfap46 UTSW 7 139,219,616 (GRCm39) missense probably benign 0.09
R7163:Cfap46 UTSW 7 139,197,994 (GRCm39) critical splice donor site probably null
R7232:Cfap46 UTSW 7 139,197,493 (GRCm39) missense unknown
R7327:Cfap46 UTSW 7 139,215,062 (GRCm39) splice site probably null
R7336:Cfap46 UTSW 7 139,200,020 (GRCm39) missense unknown
R7337:Cfap46 UTSW 7 139,210,492 (GRCm39) critical splice donor site probably null
R7437:Cfap46 UTSW 7 139,230,753 (GRCm39) nonsense probably null
R7450:Cfap46 UTSW 7 139,197,353 (GRCm39) missense unknown
R7495:Cfap46 UTSW 7 139,183,112 (GRCm39) critical splice donor site probably null
R7618:Cfap46 UTSW 7 139,183,155 (GRCm39) missense
R7623:Cfap46 UTSW 7 139,198,266 (GRCm39) missense unknown
R7765:Cfap46 UTSW 7 139,231,480 (GRCm39) missense
R7971:Cfap46 UTSW 7 139,215,043 (GRCm39) missense unknown
R8211:Cfap46 UTSW 7 139,213,220 (GRCm39) missense unknown
R8306:Cfap46 UTSW 7 139,236,496 (GRCm39) missense
R8354:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably benign 0.03
R8365:Cfap46 UTSW 7 139,263,000 (GRCm39) nonsense probably null
R8447:Cfap46 UTSW 7 139,260,902 (GRCm39) missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139,185,560 (GRCm39) missense
R8805:Cfap46 UTSW 7 139,211,979 (GRCm39) missense unknown
R8830:Cfap46 UTSW 7 139,195,565 (GRCm39) missense unknown
R8912:Cfap46 UTSW 7 139,260,097 (GRCm39) intron probably benign
R8920:Cfap46 UTSW 7 139,232,442 (GRCm39) missense
R8977:Cfap46 UTSW 7 139,259,849 (GRCm39) missense probably benign 0.01
R9048:Cfap46 UTSW 7 139,207,259 (GRCm39) missense unknown
R9224:Cfap46 UTSW 7 139,258,416 (GRCm39) nonsense probably null
R9243:Cfap46 UTSW 7 139,195,265 (GRCm39) intron probably benign
R9252:Cfap46 UTSW 7 139,198,165 (GRCm39) missense unknown
R9276:Cfap46 UTSW 7 139,201,207 (GRCm39) missense unknown
R9301:Cfap46 UTSW 7 139,222,461 (GRCm39) missense
R9391:Cfap46 UTSW 7 139,198,027 (GRCm39) missense unknown
R9402:Cfap46 UTSW 7 139,215,865 (GRCm39) missense unknown
R9443:Cfap46 UTSW 7 139,195,023 (GRCm39) missense
R9564:Cfap46 UTSW 7 139,231,471 (GRCm39) missense
R9625:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9626:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9638:Cfap46 UTSW 7 139,209,763 (GRCm39) missense unknown
R9656:Cfap46 UTSW 7 139,235,816 (GRCm39) missense
R9658:Cfap46 UTSW 7 139,246,229 (GRCm39) missense
R9747:Cfap46 UTSW 7 139,191,907 (GRCm39) missense unknown
RF023:Cfap46 UTSW 7 139,218,834 (GRCm39)
W0251:Cfap46 UTSW 7 139,183,862 (GRCm39) missense probably benign 0.11
X0018:Cfap46 UTSW 7 139,260,828 (GRCm39) missense probably benign 0.03
X0064:Cfap46 UTSW 7 139,183,363 (GRCm39) missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139,214,980 (GRCm39) missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139,219,464 (GRCm39) missense
Z1177:Cfap46 UTSW 7 139,210,542 (GRCm39) missense unknown
Z1177:Cfap46 UTSW 7 139,181,183 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCAAGGTGAATGTGGTGG -3'
(R):5'- TTTGACCCTGGCTGAGCAAC -3'

Sequencing Primer
(F):5'- TTCAGGATCCACAGCCGTC -3'
(R):5'- GACCTAAGAGCTATCTCCGATTAG -3'
Posted On 2018-04-05