Incidental Mutation 'FR4976:Cntnap1'
ID 511917
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Name contactin associated protein-like 1
Synonyms Nrxn4, NCP1, Caspr, paranodin, p190, shm
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.496) question?
Stock # FR4976 ()
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 101065429-101081550 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CCAGCC to CCAGCCTCAGCC at 101080411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
AlphaFold O54991
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 219 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,634,881 (GRCm39) probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,257 (GRCm39) probably benign Het
Akap12 AAA AAACAA 10: 4,303,837 (GRCm39) probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,062,425 (GRCm39) probably null Homo
Alg9 G GCGA 9: 50,686,731 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,162,544 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,415,057 (GRCm39) probably null Het
Atad3a C A 4: 155,838,396 (GRCm39) R207L probably damaging Homo
Blm ACCT ACCTCCCT 7: 80,113,515 (GRCm39) probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bmp5 GAGGAGT G 9: 75,683,657 (GRCm39) probably benign Homo
Bpifa6 A T 2: 153,828,296 (GRCm39) Q134L probably benign Homo
Bpifa6 A T 2: 153,828,318 (GRCm39) R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1a ACC ACCTCC 8: 85,365,355 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,701 (GRCm39) probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,228,023 (GRCm39) probably benign Homo
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,228,276 (GRCm39) probably benign Het
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Homo
Ccdc170 ACC ACCGCC 10: 4,511,023 (GRCm39) probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,511,008 (GRCm39) probably benign Het
Ccdc170 AC ACCTC 10: 4,511,029 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,152,939 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,941 (GRCm39) probably benign Het
Cep112 G GCTCT 11: 108,316,178 (GRCm39) probably benign Het
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,346 (GRCm39) probably benign Het
Cnpy3 CCT CCTACT 17: 47,047,673 (GRCm39) probably null Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,696,627 (GRCm39) probably null Het
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,685,650 (GRCm39) probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,460 (GRCm39) probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,466 (GRCm39) probably benign Het
Cul9 CTTC CTTCTTC 17: 46,811,774 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,782 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,776 (GRCm39) probably benign Het
Cybrd1 GAAT G 2: 70,968,855 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,742 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,745 (GRCm39) probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dbr1 GG GGAGGAAG 9: 99,465,755 (GRCm39) probably benign Het
Dcaf8 C T 1: 172,000,423 (GRCm39) H194Y probably damaging Homo
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Homo
Dennd10 T TTCA 19: 60,803,060 (GRCm39) probably benign Homo
Dnaaf9 C CTCG 2: 130,612,673 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,659 (GRCm39) probably benign Het
Dnaaf9 TCC TCCACC 2: 130,612,662 (GRCm39) probably benign Het
Dnajc19 AC ACGC 3: 34,112,143 (GRCm39) probably null Het
Dthd1 GAC GACTAC 5: 63,000,367 (GRCm39) probably benign Homo
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn CTT CTTGTT 2: 57,938,092 (GRCm39) probably benign Het
Ermn TC TCTAC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo38 TGCAGC TGC 18: 62,648,418 (GRCm39) probably benign Het
Frem3 CT CTTGT 8: 81,341,870 (GRCm39) probably benign Homo
Fsip2 TTTTT TTTTTGTTTT 2: 82,814,706 (GRCm39) probably benign Het
Fsip2 TT TTTTTCT 2: 82,814,709 (GRCm39) probably benign Het
Gabre AGGCT AGGCTGCGGCT X: 71,314,024 (GRCm39) probably benign Homo
Gabre T TGAGGCC X: 71,314,028 (GRCm39) probably benign Homo
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Homo
Gm14393 T G 2: 174,903,613 (GRCm39) N98T probably benign Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,255,061 (GRCm39) probably benign Homo
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Golga5 G A 12: 102,441,919 (GRCm39) probably null Homo
Gpatch11 AGGAA AGGAAGTGGAA 17: 79,149,609 (GRCm39) probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 79,149,602 (GRCm39) probably null Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,599 (GRCm39) probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,601 (GRCm39) probably benign Het
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 118,112,344 (GRCm39) probably benign Homo
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igf1r C CTGGAGATGGAGA 7: 67,875,934 (GRCm39) probably benign Het
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGTGG 14: 26,804,634 (GRCm39) probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,179,978 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,510,469 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGGACATTG 6: 145,119,511 (GRCm39) probably benign Homo
Isg20l2 AAG AAGTAG 3: 87,839,022 (GRCm39) probably null Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,285,787 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,798 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,785 (GRCm39) probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,520,761 (GRCm39) probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,488,830 (GRCm39) probably benign Homo
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Las1l A AGGC X: 94,984,439 (GRCm39) probably benign Het
Las1l AGG AGGGGG X: 94,984,433 (GRCm39) probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,357,854 (GRCm39) probably benign Het
Lrit3 CATA CATAAATA 3: 129,597,559 (GRCm39) probably benign Homo
Mamld1 GCA GCAACA X: 70,162,424 (GRCm39) probably benign Het
Mamld1 GCAACA GCAACAACA X: 70,162,418 (GRCm39) probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,872,820 (GRCm39) probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,875,755 (GRCm39) probably null Homo
Med12l GCA GCACCA 3: 59,183,398 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,568 (GRCm39) probably benign Het
Morf4l2 T C X: 135,634,371 (GRCm39) K286E probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,067,587 (GRCm39) probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,549,756 (GRCm39) probably benign Het
Nacad A ACCAGGG 11: 6,549,749 (GRCm39) probably benign Het
Nacad C CAGGGTA 11: 6,549,763 (GRCm39) probably benign Het
Nars1 CCACTCAC CCAC 18: 64,643,516 (GRCm39) probably benign Homo
Ndufc2 C T 7: 97,049,481 (GRCm39) P29L probably damaging Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l CTG CTGGTG 4: 156,324,555 (GRCm39) probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,069,814 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51f1e T TTAC 7: 102,747,516 (GRCm39) probably benign Homo
Or51v8 AG AGAGG 7: 103,320,173 (GRCm39) probably benign Homo
Or52b4 A AAACCG 7: 102,184,888 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Patl2 CTG CTGGTG 2: 121,956,620 (GRCm39) probably benign Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 GC GCTTC 2: 121,956,625 (GRCm39) probably benign Het
Patl2 GCT GCTTCT 2: 121,956,622 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Homo
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,844,104 (GRCm39) probably benign Het
Pick1 TTC TTCTC 15: 79,140,146 (GRCm39) probably null Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,612,652 (GRCm39) probably null Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pogz GTAAT G 3: 94,782,006 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ppp2r5c G T 12: 110,507,172 (GRCm39) probably null Homo
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prr13 CACT CACTACT 15: 102,370,606 (GRCm39) probably benign Homo
Prr13 CTC CTCTTC 15: 102,370,611 (GRCm39) probably benign Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Homo
Rpa1 TGCTGCC T 11: 75,209,345 (GRCm39) probably benign Het
Rpgrip1 GGA GGATGA 14: 52,386,851 (GRCm39) probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,387,001 (GRCm39) probably benign Het
Rps19 AGCGG AG 7: 24,588,421 (GRCm39) probably benign Homo
Rsf1 G GACC 7: 97,229,116 (GRCm39) probably benign Homo
Serpina3m A G 12: 104,324,882 (GRCm39) probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,384,488 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,373,060 (GRCm39) probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 CG CGGGG 17: 85,928,799 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,786 (GRCm39) probably benign Het
Skint8 C T 4: 111,796,099 (GRCm39) L258F probably benign Homo
Smoc2 AGTT A 17: 14,621,824 (GRCm39) probably benign Homo
Smpx CCCCCA C X: 156,503,920 (GRCm39) probably benign Homo
Snx1 TC TCTGC 9: 66,012,211 (GRCm39) probably benign Homo
Snx1 C CTTT 9: 66,012,212 (GRCm39) probably benign Homo
Sp110 CT CTAAT 1: 85,515,210 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 (GRCm39) probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 (GRCm39) probably benign Het
Spag17 AGG AGGTGG 3: 99,963,570 (GRCm39) probably benign Het
Spag17 GGA GGACGA 3: 99,963,571 (GRCm39) probably benign Het
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 (GRCm39) probably benign Homo
Stard8 AGG AGGTGG X: 98,110,131 (GRCm39) probably benign Het
Stard8 AGG AGGTGG X: 98,110,119 (GRCm39) probably benign Het
Stk10 CCCA C 11: 32,564,520 (GRCm39) probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,424,673 (GRCm39) probably benign Homo
Tbc1d5 G C 17: 51,106,959 (GRCm39) H532Q probably benign Homo
Tbc1d5 C G 17: 51,106,971 (GRCm39) Q528H probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tmcc1 G A 6: 116,170,341 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,887,214 (GRCm39) probably benign Homo
Trim16 GTGA GTGATGA 11: 62,711,515 (GRCm39) probably benign Homo
Tsbp1 AGC AGCGGC 17: 34,679,032 (GRCm39) probably benign Het
Tsbp1 AGC AGCGGC 17: 34,679,035 (GRCm39) probably benign Het
Tsen2 AGG AGGCGG 6: 115,537,027 (GRCm39) probably benign Homo
Ubtf TC TCCGC 11: 102,197,785 (GRCm39) probably benign Het
Vmn1r124 G T 7: 20,993,861 (GRCm39) Q228K possibly damaging Het
Vmn1r71 A C 7: 10,482,048 (GRCm39) S147R probably benign Homo
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Homo
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,862,564 (GRCm39) probably benign Homo
Zfp111 T G 7: 23,898,462 (GRCm39) K383T probably damaging Homo
Zfp111 A ATCG 7: 23,899,232 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TCC TCCACC 2: 164,749,398 (GRCm39) probably benign Het
Zfp335 CTC CTCTTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp459 A AGTGG 13: 67,556,395 (GRCm39) probably null Homo
Zfp459 TGA TGAGAGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 (GRCm39) probably benign Het
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp683 AG AGGGG 4: 133,786,190 (GRCm39) probably benign Homo
Zpld2 TG TGCCG 4: 133,929,941 (GRCm39) probably benign Homo
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101,075,918 (GRCm39) missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101,074,031 (GRCm39) splice site probably benign
IGL00792:Cntnap1 APN 11 101,069,792 (GRCm39) missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101,072,614 (GRCm39) missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101,069,633 (GRCm39) splice site probably benign
IGL02184:Cntnap1 APN 11 101,069,191 (GRCm39) missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101,069,142 (GRCm39) missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101,073,080 (GRCm39) missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101,077,677 (GRCm39) missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101,068,955 (GRCm39) missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101,075,575 (GRCm39) missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101,067,127 (GRCm39) missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101,072,508 (GRCm39) missense possibly damaging 0.94
Penny UTSW 11 101,077,590 (GRCm39) missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101,080,415 (GRCm39) unclassified probably benign
FR4304:Cntnap1 UTSW 11 101,080,407 (GRCm39) unclassified probably benign
FR4342:Cntnap1 UTSW 11 101,080,401 (GRCm39) unclassified probably benign
FR4449:Cntnap1 UTSW 11 101,080,419 (GRCm39) unclassified probably benign
FR4449:Cntnap1 UTSW 11 101,080,395 (GRCm39) unclassified probably benign
FR4548:Cntnap1 UTSW 11 101,080,419 (GRCm39) unclassified probably benign
FR4548:Cntnap1 UTSW 11 101,080,405 (GRCm39) unclassified probably benign
FR4548:Cntnap1 UTSW 11 101,080,398 (GRCm39) unclassified probably benign
FR4548:Cntnap1 UTSW 11 101,080,420 (GRCm39) unclassified probably benign
FR4589:Cntnap1 UTSW 11 101,080,401 (GRCm39) unclassified probably benign
FR4589:Cntnap1 UTSW 11 101,080,392 (GRCm39) unclassified probably benign
FR4589:Cntnap1 UTSW 11 101,080,407 (GRCm39) unclassified probably benign
FR4589:Cntnap1 UTSW 11 101,080,406 (GRCm39) unclassified probably benign
FR4737:Cntnap1 UTSW 11 101,080,416 (GRCm39) unclassified probably benign
FR4737:Cntnap1 UTSW 11 101,080,395 (GRCm39) unclassified probably benign
FR4737:Cntnap1 UTSW 11 101,080,402 (GRCm39) unclassified probably benign
FR4737:Cntnap1 UTSW 11 101,080,408 (GRCm39) unclassified probably benign
FR4976:Cntnap1 UTSW 11 101,080,395 (GRCm39) unclassified probably benign
FR4976:Cntnap1 UTSW 11 101,080,398 (GRCm39) unclassified probably benign
FR4976:Cntnap1 UTSW 11 101,080,414 (GRCm39) unclassified probably benign
PIT4354001:Cntnap1 UTSW 11 101,072,123 (GRCm39) missense probably damaging 1.00
PIT4466001:Cntnap1 UTSW 11 101,068,131 (GRCm39) missense probably benign
R0329:Cntnap1 UTSW 11 101,079,135 (GRCm39) missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101,074,822 (GRCm39) missense probably benign
R0586:Cntnap1 UTSW 11 101,077,840 (GRCm39) missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101,074,285 (GRCm39) missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101,072,210 (GRCm39) splice site probably benign
R1016:Cntnap1 UTSW 11 101,068,333 (GRCm39) missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101,069,662 (GRCm39) missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101,075,536 (GRCm39) missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101,071,186 (GRCm39) missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101,071,186 (GRCm39) missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101,071,186 (GRCm39) missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101,079,699 (GRCm39) splice site probably null
R1758:Cntnap1 UTSW 11 101,075,449 (GRCm39) missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101,077,337 (GRCm39) missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101,068,850 (GRCm39) nonsense probably null
R1966:Cntnap1 UTSW 11 101,071,212 (GRCm39) missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101,073,805 (GRCm39) missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101,073,373 (GRCm39) missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101,079,483 (GRCm39) missense probably benign
R3795:Cntnap1 UTSW 11 101,077,590 (GRCm39) missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101,073,079 (GRCm39) missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101,068,898 (GRCm39) missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101,073,845 (GRCm39) missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101,068,251 (GRCm39) missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101,067,159 (GRCm39) splice site probably null
R5008:Cntnap1 UTSW 11 101,079,567 (GRCm39) nonsense probably null
R5399:Cntnap1 UTSW 11 101,074,142 (GRCm39) missense probably benign
R5507:Cntnap1 UTSW 11 101,074,303 (GRCm39) missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101,073,261 (GRCm39) missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101,075,944 (GRCm39) missense probably benign
R6038:Cntnap1 UTSW 11 101,075,462 (GRCm39) missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101,075,462 (GRCm39) missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101,073,364 (GRCm39) missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101,075,441 (GRCm39) missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101,077,472 (GRCm39) missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101,068,060 (GRCm39) missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101,077,337 (GRCm39) missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101,073,730 (GRCm39) missense probably damaging 0.97
R7152:Cntnap1 UTSW 11 101,068,152 (GRCm39) missense probably damaging 1.00
R7297:Cntnap1 UTSW 11 101,079,460 (GRCm39) missense probably benign 0.01
R7347:Cntnap1 UTSW 11 101,076,094 (GRCm39) missense probably damaging 1.00
R7961:Cntnap1 UTSW 11 101,069,121 (GRCm39) missense probably benign
R7980:Cntnap1 UTSW 11 101,079,719 (GRCm39) missense probably benign
R8307:Cntnap1 UTSW 11 101,079,702 (GRCm39) missense possibly damaging 0.73
R8386:Cntnap1 UTSW 11 101,073,029 (GRCm39) missense probably damaging 1.00
R8403:Cntnap1 UTSW 11 101,068,416 (GRCm39) missense probably damaging 1.00
R8826:Cntnap1 UTSW 11 101,077,655 (GRCm39) missense probably damaging 0.99
R9103:Cntnap1 UTSW 11 101,072,094 (GRCm39) missense probably benign 0.06
R9279:Cntnap1 UTSW 11 101,072,121 (GRCm39) missense probably damaging 0.99
R9284:Cntnap1 UTSW 11 101,068,137 (GRCm39) missense probably benign
R9386:Cntnap1 UTSW 11 101,076,052 (GRCm39) missense probably damaging 1.00
R9689:Cntnap1 UTSW 11 101,072,178 (GRCm39) missense probably damaging 0.98
R9697:Cntnap1 UTSW 11 101,068,828 (GRCm39) missense possibly damaging 0.51
RF042:Cntnap1 UTSW 11 101,071,131 (GRCm39) critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101,080,389 (GRCm39) unclassified probably benign
RF048:Cntnap1 UTSW 11 101,071,131 (GRCm39) critical splice acceptor site probably benign
RF049:Cntnap1 UTSW 11 101,080,422 (GRCm39) unclassified probably benign
RF049:Cntnap1 UTSW 11 101,080,418 (GRCm39) unclassified probably benign
RF050:Cntnap1 UTSW 11 101,080,418 (GRCm39) unclassified probably benign
Z1176:Cntnap1 UTSW 11 101,073,724 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCAGTTTTGGTGGCC -3'
(R):5'- CAGAGCCTGCTTAGAAGAGC -3'

Sequencing Primer
(F):5'- AATGCTGGTGCTGTTCTATCTGC -3'
(R):5'- CTTAGAAGAGCCAAATGTCCCTGG -3'
Posted On 2018-04-05