Incidental Mutation 'FR4976:Mast4'
ID 511934
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # FR4976 ()
Quality Score 214.458
Status Not validated
Chromosome 13
Chromosomal Location 102868994-103471005 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GGACAAGCTGTGAGTTGGGGAACCCGGGAG to GG at 102875755 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
AlphaFold Q811L6
Predicted Effect probably null
Transcript: ENSMUST00000099202
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167058
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171791
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194446
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 221 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,634,881 (GRCm39) probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,257 (GRCm39) probably benign Het
Akap12 AAA AAACAA 10: 4,303,837 (GRCm39) probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,062,425 (GRCm39) probably null Homo
Alg9 G GCGA 9: 50,686,731 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,162,544 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,415,057 (GRCm39) probably null Het
Atad3a C A 4: 155,838,396 (GRCm39) R207L probably damaging Homo
Blm ACCT ACCTCCCT 7: 80,113,515 (GRCm39) probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bmp5 GAGGAGT G 9: 75,683,657 (GRCm39) probably benign Homo
Bpifa6 A T 2: 153,828,296 (GRCm39) Q134L probably benign Homo
Bpifa6 A T 2: 153,828,318 (GRCm39) R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1a ACC ACCTCC 8: 85,365,355 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,701 (GRCm39) probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Homo
Catsper2 C CTTTTACTTTTTT 2: 121,228,023 (GRCm39) probably benign Homo
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,228,276 (GRCm39) probably benign Het
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,511,008 (GRCm39) probably benign Het
Ccdc170 AC ACCTC 10: 4,511,029 (GRCm39) probably benign Het
Ccdc170 ACC ACCGCC 10: 4,511,023 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,152,939 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,941 (GRCm39) probably benign Het
Cep112 G GCTCT 11: 108,316,178 (GRCm39) probably benign Het
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,346 (GRCm39) probably benign Het
Cnpy3 CCT CCTACT 17: 47,047,673 (GRCm39) probably null Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,411 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,414 (GRCm39) probably benign Het
Cntnap1 A ACCCCCC 11: 101,080,395 (GRCm39) probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,696,627 (GRCm39) probably null Het
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm AGTG AGTGGGTG 13: 61,685,650 (GRCm39) probably null Homo
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,466 (GRCm39) probably benign Het
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,460 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,776 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,782 (GRCm39) probably benign Het
Cul9 CTTC CTTCTTC 17: 46,811,774 (GRCm39) probably benign Het
Cybrd1 GAAT G 2: 70,968,855 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,742 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,745 (GRCm39) probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dbr1 GG GGAGGAAG 9: 99,465,755 (GRCm39) probably benign Het
Dcaf8 C T 1: 172,000,423 (GRCm39) H194Y probably damaging Homo
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Homo
Dennd10 T TTCA 19: 60,803,060 (GRCm39) probably benign Homo
Dnaaf9 C CTCG 2: 130,612,673 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,659 (GRCm39) probably benign Het
Dnaaf9 TCC TCCACC 2: 130,612,662 (GRCm39) probably benign Het
Dnajc19 AC ACGC 3: 34,112,143 (GRCm39) probably null Het
Dthd1 GAC GACTAC 5: 63,000,367 (GRCm39) probably benign Homo
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn CTT CTTGTT 2: 57,938,092 (GRCm39) probably benign Het
Ermn TC TCTAC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo38 TGCAGC TGC 18: 62,648,418 (GRCm39) probably benign Het
Frem3 CT CTTGT 8: 81,341,870 (GRCm39) probably benign Homo
Fsip2 TT TTTTTCT 2: 82,814,709 (GRCm39) probably benign Het
Fsip2 TTTTT TTTTTGTTTT 2: 82,814,706 (GRCm39) probably benign Het
Gabre T TGAGGCC X: 71,314,028 (GRCm39) probably benign Homo
Gabre AGGCT AGGCTGCGGCT X: 71,314,024 (GRCm39) probably benign Homo
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Homo
Gm14393 T G 2: 174,903,613 (GRCm39) N98T probably benign Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,255,061 (GRCm39) probably benign Homo
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Golga5 G A 12: 102,441,919 (GRCm39) probably null Homo
Gpatch11 AGGAA AGGAAGTGGAA 17: 79,149,609 (GRCm39) probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 79,149,602 (GRCm39) probably null Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,601 (GRCm39) probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,599 (GRCm39) probably benign Het
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 118,112,344 (GRCm39) probably benign Homo
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igf1r C CTGGAGATGGAGA 7: 67,875,934 (GRCm39) probably benign Het
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGTGG 14: 26,804,634 (GRCm39) probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,179,978 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,510,469 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGGACATTG 6: 145,119,511 (GRCm39) probably benign Homo
Isg20l2 AAG AAGTAG 3: 87,839,022 (GRCm39) probably null Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,798 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,785 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,285,787 (GRCm39) probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,520,761 (GRCm39) probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,488,830 (GRCm39) probably benign Homo
Las1l AGG AGGGGG X: 94,984,433 (GRCm39) probably benign Het
Las1l A AGGC X: 94,984,439 (GRCm39) probably benign Het
Las1l GA GAGAA X: 94,984,438 (GRCm39) probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,357,854 (GRCm39) probably benign Het
Lrit3 CATA CATAAATA 3: 129,597,559 (GRCm39) probably benign Homo
Mamld1 GCAACA GCAACAACA X: 70,162,418 (GRCm39) probably benign Het
Mamld1 GCA GCAACA X: 70,162,424 (GRCm39) probably benign Het
Med12l GCA GCACCA 3: 59,183,398 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,568 (GRCm39) probably benign Het
Morf4l2 T C X: 135,634,371 (GRCm39) K286E probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,067,587 (GRCm39) probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,549,756 (GRCm39) probably benign Het
Nacad A ACCAGGG 11: 6,549,749 (GRCm39) probably benign Het
Nacad C CAGGGTA 11: 6,549,763 (GRCm39) probably benign Het
Nars1 CCACTCAC CCAC 18: 64,643,516 (GRCm39) probably benign Homo
Ndufc2 C T 7: 97,049,481 (GRCm39) P29L probably damaging Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l CTG CTGGTG 4: 156,324,555 (GRCm39) probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,069,814 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51f1e T TTAC 7: 102,747,516 (GRCm39) probably benign Homo
Or51v8 AG AGAGG 7: 103,320,173 (GRCm39) probably benign Homo
Or52b4 A AAACCG 7: 102,184,888 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Patl2 GCT GCTTCT 2: 121,956,622 (GRCm39) probably benign Het
Patl2 CTG CTGGTG 2: 121,956,620 (GRCm39) probably benign Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 GC GCTTC 2: 121,956,625 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Homo
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,844,104 (GRCm39) probably benign Het
Pick1 TTC TTCTC 15: 79,140,146 (GRCm39) probably null Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,612,652 (GRCm39) probably null Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pogz GTAAT G 3: 94,782,006 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ppp2r5c G T 12: 110,507,172 (GRCm39) probably null Homo
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prr13 CTC CTCTTC 15: 102,370,611 (GRCm39) probably benign Homo
Prr13 CACT CACTACT 15: 102,370,606 (GRCm39) probably benign Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Homo
Rpa1 TGCTGCC T 11: 75,209,345 (GRCm39) probably benign Het
Rpgrip1 GGA GGATGA 14: 52,386,851 (GRCm39) probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,387,001 (GRCm39) probably benign Het
Rps19 AGCGG AG 7: 24,588,421 (GRCm39) probably benign Homo
Rsf1 G GACC 7: 97,229,116 (GRCm39) probably benign Homo
Serpina3m A G 12: 104,324,882 (GRCm39) probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,384,488 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,373,060 (GRCm39) probably benign Homo
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CG CGGGG 17: 85,928,799 (GRCm39) probably benign Het
Skint8 C T 4: 111,796,099 (GRCm39) L258F probably benign Homo
Smoc2 AGTT A 17: 14,621,824 (GRCm39) probably benign Homo
Smpx CCCCCA C X: 156,503,920 (GRCm39) probably benign Homo
Snx1 C CTTT 9: 66,012,212 (GRCm39) probably benign Homo
Snx1 TC TCTGC 9: 66,012,211 (GRCm39) probably benign Homo
Sp110 CT CTAAT 1: 85,515,210 (GRCm39) probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 (GRCm39) probably benign Het
Spag17 GGA GGACGA 3: 99,963,571 (GRCm39) probably benign Het
Spag17 AGG AGGTGG 3: 99,963,570 (GRCm39) probably benign Het
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 (GRCm39) probably benign Homo
Stard8 AGG AGGTGG X: 98,110,119 (GRCm39) probably benign Het
Stard8 AGG AGGTGG X: 98,110,131 (GRCm39) probably benign Het
Stk10 CCCA C 11: 32,564,520 (GRCm39) probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,424,673 (GRCm39) probably benign Homo
Tbc1d5 G C 17: 51,106,959 (GRCm39) H532Q probably benign Homo
Tbc1d5 C G 17: 51,106,971 (GRCm39) Q528H probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tmcc1 G A 6: 116,170,341 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,887,214 (GRCm39) probably benign Homo
Trim16 GTGA GTGATGA 11: 62,711,515 (GRCm39) probably benign Homo
Tsbp1 AGC AGCGGC 17: 34,679,032 (GRCm39) probably benign Het
Tsbp1 AGC AGCGGC 17: 34,679,035 (GRCm39) probably benign Het
Tsen2 AGG AGGCGG 6: 115,537,027 (GRCm39) probably benign Homo
Ubtf TC TCCGC 11: 102,197,785 (GRCm39) probably benign Het
Vmn1r124 G T 7: 20,993,861 (GRCm39) Q228K possibly damaging Het
Vmn1r71 A C 7: 10,482,048 (GRCm39) S147R probably benign Homo
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Homo
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,862,564 (GRCm39) probably benign Homo
Zfp111 T G 7: 23,898,462 (GRCm39) K383T probably damaging Homo
Zfp111 A ATCG 7: 23,899,232 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TCC TCCACC 2: 164,749,398 (GRCm39) probably benign Het
Zfp335 CTC CTCTTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp459 A AGTGG 13: 67,556,395 (GRCm39) probably null Homo
Zfp459 TGA TGAGAGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 (GRCm39) probably benign Het
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp683 AG AGGGG 4: 133,786,190 (GRCm39) probably benign Homo
Zpld2 TG TGCCG 4: 133,929,941 (GRCm39) probably benign Homo
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102,907,275 (GRCm39) nonsense probably null
IGL00933:Mast4 APN 13 102,871,874 (GRCm39) missense probably damaging 0.97
IGL01113:Mast4 APN 13 102,910,744 (GRCm39) missense probably damaging 1.00
IGL01461:Mast4 APN 13 102,890,576 (GRCm39) missense probably damaging 1.00
IGL01569:Mast4 APN 13 102,897,523 (GRCm39) missense probably damaging 1.00
IGL01697:Mast4 APN 13 102,904,401 (GRCm39) missense probably damaging 1.00
IGL01725:Mast4 APN 13 102,887,020 (GRCm39) critical splice donor site probably null
IGL01734:Mast4 APN 13 102,874,123 (GRCm39) missense probably damaging 0.98
IGL01738:Mast4 APN 13 102,873,749 (GRCm39) missense probably damaging 1.00
IGL01739:Mast4 APN 13 102,910,781 (GRCm39) missense probably damaging 1.00
IGL02299:Mast4 APN 13 102,874,482 (GRCm39) missense probably benign 0.44
IGL02479:Mast4 APN 13 102,878,545 (GRCm39) missense probably damaging 1.00
IGL02485:Mast4 APN 13 102,872,004 (GRCm39) missense probably benign 0.02
IGL02528:Mast4 APN 13 102,990,331 (GRCm39) makesense probably null
IGL02850:Mast4 APN 13 102,890,740 (GRCm39) missense probably damaging 1.00
IGL02900:Mast4 APN 13 102,872,184 (GRCm39) missense probably benign
IGL03064:Mast4 APN 13 102,897,472 (GRCm39) nonsense probably null
IGL03124:Mast4 APN 13 102,874,753 (GRCm39) missense probably damaging 1.00
IGL03146:Mast4 APN 13 102,874,163 (GRCm39) missense probably benign 0.00
IGL03221:Mast4 APN 13 102,890,764 (GRCm39) missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102,887,905 (GRCm39) missense probably damaging 1.00
IGL03406:Mast4 APN 13 102,873,615 (GRCm39) missense possibly damaging 0.46
buck UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
doe UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
skinnybones UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
BB010:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
BB020:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102,871,370 (GRCm39) utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102,872,825 (GRCm39) small insertion probably benign
FR4340:Mast4 UTSW 13 102,871,365 (GRCm39) frame shift probably null
FR4548:Mast4 UTSW 13 102,872,826 (GRCm39) small insertion probably benign
FR4976:Mast4 UTSW 13 102,872,820 (GRCm39) small insertion probably benign
NA:Mast4 UTSW 13 102,878,565 (GRCm39) missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
R0009:Mast4 UTSW 13 102,878,566 (GRCm39) missense probably damaging 1.00
R0063:Mast4 UTSW 13 103,470,723 (GRCm39) start gained probably benign
R0242:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R0310:Mast4 UTSW 13 102,890,669 (GRCm39) missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102,871,781 (GRCm39) missense probably damaging 1.00
R0454:Mast4 UTSW 13 102,888,068 (GRCm39) missense probably damaging 1.00
R0646:Mast4 UTSW 13 102,895,252 (GRCm39) splice site probably benign
R0744:Mast4 UTSW 13 102,873,895 (GRCm39) missense probably damaging 0.98
R0883:Mast4 UTSW 13 102,990,408 (GRCm39) missense probably damaging 1.00
R0905:Mast4 UTSW 13 102,907,292 (GRCm39) missense probably damaging 0.99
R1023:Mast4 UTSW 13 102,872,004 (GRCm39) missense probably benign 0.02
R1281:Mast4 UTSW 13 102,887,086 (GRCm39) missense probably damaging 1.00
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102,909,027 (GRCm39) missense probably damaging 1.00
R1572:Mast4 UTSW 13 102,873,431 (GRCm39) missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102,875,771 (GRCm39) missense probably damaging 1.00
R1865:Mast4 UTSW 13 102,930,625 (GRCm39) missense probably damaging 1.00
R2050:Mast4 UTSW 13 102,887,917 (GRCm39) missense probably damaging 1.00
R2060:Mast4 UTSW 13 102,875,354 (GRCm39) missense probably damaging 1.00
R2062:Mast4 UTSW 13 102,895,601 (GRCm39) missense probably benign 0.18
R2106:Mast4 UTSW 13 102,887,054 (GRCm39) missense probably damaging 1.00
R2118:Mast4 UTSW 13 102,890,713 (GRCm39) missense probably damaging 1.00
R2143:Mast4 UTSW 13 102,871,983 (GRCm39) missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102,872,259 (GRCm39) missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102,934,715 (GRCm39) splice site probably benign
R2370:Mast4 UTSW 13 102,910,695 (GRCm39) missense probably damaging 1.00
R2504:Mast4 UTSW 13 102,875,147 (GRCm39) missense probably damaging 0.96
R2509:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R2842:Mast4 UTSW 13 102,872,939 (GRCm39) missense probably benign 0.01
R3087:Mast4 UTSW 13 102,990,434 (GRCm39) splice site probably benign
R3434:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3435:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3763:Mast4 UTSW 13 102,923,927 (GRCm39) missense probably damaging 1.00
R3826:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3829:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3830:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3913:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R3914:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4021:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4022:Mast4 UTSW 13 102,990,377 (GRCm39) missense probably damaging 1.00
R4022:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4210:Mast4 UTSW 13 102,875,713 (GRCm39) missense probably damaging 1.00
R4342:Mast4 UTSW 13 102,910,756 (GRCm39) missense probably damaging 1.00
R4580:Mast4 UTSW 13 102,873,766 (GRCm39) nonsense probably null
R4627:Mast4 UTSW 13 103,470,529 (GRCm39) missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103,470,627 (GRCm39) missense probably benign 0.01
R4732:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4733:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4833:Mast4 UTSW 13 102,910,692 (GRCm39) critical splice donor site probably null
R4995:Mast4 UTSW 13 103,042,262 (GRCm39) intron probably benign
R5059:Mast4 UTSW 13 102,887,071 (GRCm39) missense probably damaging 1.00
R5073:Mast4 UTSW 13 102,875,391 (GRCm39) nonsense probably null
R5101:Mast4 UTSW 13 102,872,864 (GRCm39) missense probably benign 0.01
R5526:Mast4 UTSW 13 102,890,723 (GRCm39) missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102,873,987 (GRCm39) missense probably damaging 1.00
R5673:Mast4 UTSW 13 102,930,580 (GRCm39) missense probably damaging 1.00
R5694:Mast4 UTSW 13 102,910,701 (GRCm39) nonsense probably null
R5906:Mast4 UTSW 13 102,872,252 (GRCm39) missense probably benign 0.31
R5908:Mast4 UTSW 13 102,874,764 (GRCm39) missense probably damaging 1.00
R5947:Mast4 UTSW 13 102,872,148 (GRCm39) missense probably benign
R5987:Mast4 UTSW 13 102,895,242 (GRCm39) missense probably damaging 1.00
R6143:Mast4 UTSW 13 102,990,391 (GRCm39) missense probably damaging 1.00
R6154:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6169:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6239:Mast4 UTSW 13 102,872,717 (GRCm39) missense probably benign 0.01
R6327:Mast4 UTSW 13 102,897,890 (GRCm39) missense probably damaging 1.00
R6356:Mast4 UTSW 13 102,872,493 (GRCm39) missense possibly damaging 0.80
R6432:Mast4 UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
R6667:Mast4 UTSW 13 102,874,004 (GRCm39) missense probably damaging 1.00
R6941:Mast4 UTSW 13 102,941,222 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,934,586 (GRCm39) missense probably damaging 1.00
R6970:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6980:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6991:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6992:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6993:Mast4 UTSW 13 102,872,482 (GRCm39) missense probably benign 0.28
R6993:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R7083:Mast4 UTSW 13 102,874,223 (GRCm39) missense probably damaging 1.00
R7241:Mast4 UTSW 13 103,470,508 (GRCm39) missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102,874,986 (GRCm39) missense probably damaging 1.00
R7246:Mast4 UTSW 13 102,930,511 (GRCm39) missense probably damaging 1.00
R7332:Mast4 UTSW 13 102,887,932 (GRCm39) missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
R7514:Mast4 UTSW 13 102,923,934 (GRCm39) nonsense probably null
R7697:Mast4 UTSW 13 102,875,711 (GRCm39) missense probably damaging 1.00
R7820:Mast4 UTSW 13 102,890,596 (GRCm39) missense probably damaging 1.00
R7874:Mast4 UTSW 13 102,875,783 (GRCm39) missense probably damaging 1.00
R7933:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
R8042:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.96
R8060:Mast4 UTSW 13 102,874,184 (GRCm39) missense possibly damaging 0.89
R8172:Mast4 UTSW 13 103,089,633 (GRCm39) critical splice donor site probably null
R8206:Mast4 UTSW 13 102,872,247 (GRCm39) missense probably damaging 1.00
R8248:Mast4 UTSW 13 102,875,229 (GRCm39) missense probably damaging 1.00
R8283:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R8346:Mast4 UTSW 13 102,887,986 (GRCm39) missense probably damaging 0.99
R8434:Mast4 UTSW 13 102,897,900 (GRCm39) missense probably damaging 1.00
R8796:Mast4 UTSW 13 102,919,899 (GRCm39) missense probably benign 0.07
R8850:Mast4 UTSW 13 102,895,174 (GRCm39) missense probably damaging 1.00
R9012:Mast4 UTSW 13 102,934,606 (GRCm39) missense probably benign 0.05
R9375:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.99
R9389:Mast4 UTSW 13 103,470,438 (GRCm39) missense probably benign 0.00
R9404:Mast4 UTSW 13 102,887,933 (GRCm39) missense probably damaging 1.00
R9520:Mast4 UTSW 13 102,925,532 (GRCm39) missense probably damaging 1.00
R9525:Mast4 UTSW 13 102,872,944 (GRCm39) missense probably benign 0.00
R9526:Mast4 UTSW 13 102,873,593 (GRCm39) missense probably benign 0.00
R9709:Mast4 UTSW 13 102,910,711 (GRCm39) missense probably damaging 1.00
R9790:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
R9791:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
RF005:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF015:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
RF019:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF037:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF039:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF040:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
Z1088:Mast4 UTSW 13 102,875,027 (GRCm39) missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102,874,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGGCTTCTTCTACAAG -3'
(R):5'- AGAAGGTTCTGAGCCCTGTG -3'

Sequencing Primer
(F):5'- TAGACAGAATGGCCCCCAATTGTG -3'
(R):5'- GTGCTTCTCTGTCTCCACTTAGG -3'
Posted On 2018-04-05