Incidental Mutation 'FR4976:Apc'
List |< first << previous [record 48 of 1113] next >> last >|
ID511974
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.980) question?
Stock #FR4976 ()
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) AATAAAGC to AATAAAGCCTATAAAGC at 34282000 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066133] [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably benign
Transcript: ENSMUST00000066133
SMART Domains Protein: ENSMUSP00000064214
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 8e-29 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 2.3e-32 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079362
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115781
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170023
Predicted Effect probably benign
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 220 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,668,447 probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930402H24Rik TCC TCCCCC 2: 130,770,739 probably benign Het
4930402H24Rik TCC TCCACC 2: 130,770,742 probably benign Het
4930402H24Rik C CTCG 2: 130,770,753 probably benign Het
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,229 probably benign Het
Akap12 AAA AAACAA 10: 4,353,837 probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,244,561 probably null Homo
Alg9 G GCGA 9: 50,775,431 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,272,532 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Atad3a C A 4: 155,753,939 R207L probably damaging Homo
BC051142 AGC AGCGGC 17: 34,460,058 probably benign Het
BC051142 AGC AGCGGC 17: 34,460,061 probably benign Het
Blm ACCT ACCTCCCT 7: 80,463,767 probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Bmp5 GAGGAGT G 9: 75,776,375 probably benign Homo
Bpifa6 A T 2: 153,986,376 Q134L probably benign Homo
Bpifa6 A T 2: 153,986,398 R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,717 probably benign Het
Cacna1a ACC ACCTCC 8: 84,638,726 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,262 probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,397,542 probably benign Homo
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,397,795 probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,561,008 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCTC 10: 4,561,029 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,019,867 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,869 probably benign Het
Cep112 G GCTCT 11: 108,425,352 probably benign Het
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,520 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,747 probably null Het
Cntnap1 A ACCCCCC 11: 101,189,569 probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,585 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,588 probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,718,906 probably null Het
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,537,836 probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,461 probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,467 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,850 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,856 probably benign Het
Cybrd1 GAAT G 2: 71,138,511 probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,689 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,692 probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dbr1 GG GGAGGAAG 9: 99,583,702 probably benign Het
Dcaf8 C T 1: 172,172,856 H194Y probably damaging Homo
Dnajc19 AC ACGC 3: 34,057,994 probably null Het
Dthd1 GAC GACTAC 5: 62,843,024 probably benign Homo
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,080 probably benign Het
Ermn TC TCTAC 2: 58,048,088 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Homo
Fam45a T TTCA 19: 60,814,622 probably benign Homo
Fbxo38 TGCAGC TGC 18: 62,515,347 probably benign Het
Frem3 CT CTTGT 8: 80,615,241 probably benign Homo
Fsip2 TTTTT TTTTTGTTTT 2: 82,984,362 probably benign Het
Fsip2 TT TTTTTCT 2: 82,984,365 probably benign Het
Gabre AGGCT AGGCTGCGGCT X: 72,270,418 probably benign Homo
Gabre T TGAGGCC X: 72,270,422 probably benign Homo
Gm10800 A AC 2: 98,667,033 probably null Homo
Gm14393 T G 2: 175,061,820 N98T probably benign Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,327,323 probably benign Homo
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gm7534 TG TGCCG 4: 134,202,630 probably benign Homo
Golga5 G A 12: 102,475,660 probably benign Homo
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,170 probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,172 probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 78,842,173 probably null Het
Gpatch11 AGGAA AGGAAGTGGAA 17: 78,842,180 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 117,975,808 probably benign Homo
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Igf1r C CTGGAGATGGAGA 7: 68,226,186 probably benign Het
Il17rd CGG CGGTGG 14: 27,082,677 probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,125,829 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,616,676 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,715 probably null Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,360 probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,586,362 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,373 probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,763 probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,598,004 probably benign Homo
Las1l AGG AGGGGG X: 95,940,827 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Las1l A AGGC X: 95,940,833 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 93,018,148 probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,450,572 probably benign Het
Lrit3 CATA CATAAATA 3: 129,803,910 probably benign Homo
Lrmp CACATTG CACATTGAGGACATTG 6: 145,173,785 probably benign Homo
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 GCA GCAACA X: 71,118,818 probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,736,312 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Homo
Med12l GCA GCACCA 3: 59,275,977 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,702 probably benign Het
Morf4l2 T C X: 136,733,622 K286E probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,149,350 probably benign Het
Nacad A ACCAGGG 11: 6,599,749 probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,599,756 probably benign Het
Nacad C CAGGGTA 11: 6,599,763 probably benign Het
Nars CCACTCAC CCAC 18: 64,510,445 probably benign Homo
Ndufc2 C T 7: 97,400,274 P29L probably damaging Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l CTG CTGGTG 4: 156,240,098 probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,081,356 probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,081,375 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr547 A AAACCG 7: 102,535,681 probably null Homo
Olfr585 T TTAC 7: 103,098,309 probably benign Homo
Olfr624 AG AGAGG 7: 103,670,966 probably benign Homo
Patl2 CTG CTGGTG 2: 122,126,139 probably benign Het
Patl2 GCT GCTTCT 2: 122,126,141 probably benign Het
Patl2 GC GCTTC 2: 122,126,144 probably benign Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Homo
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,805,023 probably benign Het
Pick1 TTC TTCTC 15: 79,255,946 probably null Homo
Piezo1 G A 8: 122,495,569 R942W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,635,654 probably null Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pogz GTAAT G 3: 94,874,695 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ppp2r5c G T 12: 110,540,738 probably benign Homo
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prr13 CACT CACTACT 15: 102,462,171 probably benign Homo
Prr13 CTC CTCTTC 15: 102,462,176 probably benign Homo
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,489,267 probably benign Homo
Rpa1 TGCTGCC T 11: 75,318,519 probably benign Het
Rpgrip1 GGA GGATGA 14: 52,149,394 probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,149,544 probably benign Het
Rps19 AGCGG AG 7: 24,888,996 probably benign Homo
Rsf1 G GACC 7: 97,579,909 probably benign Homo
Serpina3m A G 12: 104,358,623 probably benign Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,785,316 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,423,060 probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GCG GCGTCG 17: 85,621,358 probably benign Het
Six3 CG CGGGG 17: 85,621,371 probably benign Het
Skint8 C T 4: 111,938,902 L258F probably benign Homo
Smoc2 AGTT A 17: 14,401,562 probably benign Homo
Smpx CCCCCA C X: 157,720,924 probably benign Homo
Snx1 TC TCTGC 9: 66,104,929 probably benign Homo
Snx1 C CTTT 9: 66,104,930 probably benign Homo
Sp110 CT CTAAT 1: 85,587,489 probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 probably benign Het
Spag17 AGG AGGTGG 3: 100,056,254 probably benign Het
Spag17 GGA GGACGA 3: 100,056,255 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 probably benign Homo
Stard8 AGG AGGTGG X: 99,066,513 probably benign Het
Stard8 AGG AGGTGG X: 99,066,525 probably benign Het
Stk10 CCCA C 11: 32,614,520 probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,205,699 probably benign Homo
Tbc1d5 G C 17: 50,799,931 H532Q probably benign Homo
Tbc1d5 C G 17: 50,799,943 Q528H probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmcc1 G A 6: 116,193,380 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,649,757 probably benign Homo
Trim16 GTGA GTGATGA 11: 62,820,689 probably benign Homo
Tsen2 AGG AGGCGG 6: 115,560,066 probably benign Homo
Ubtf TC TCCGC 11: 102,306,959 probably benign Het
Vmn1r124 G T 7: 21,259,936 Q228K possibly damaging Het
Vmn1r71 A C 7: 10,748,121 S213R probably benign Homo
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Homo
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,823,404 probably benign Homo
Zfp111 T G 7: 24,199,037 K384T probably damaging Homo
Zfp111 A ATCG 7: 24,199,807 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,904,790 probably benign Het
Zfp335 CTC CTCTTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCACC 2: 164,907,478 probably benign Het
Zfp459 TGA TGAGAGA 13: 67,408,274 probably null Homo
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp459 A AGTGG 13: 67,408,276 probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 probably benign Het
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,782 probably benign Het
Zfp683 AG AGGGG 4: 134,058,879 probably benign Homo
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 unclassified probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 critical splice acceptor site probably benign
FR4342:Apc UTSW 18 34281999 small insertion probably benign
FR4449:Apc UTSW 18 34282000 small insertion probably benign
FR4449:Apc UTSW 18 34282005 small insertion probably benign
FR4548:Apc UTSW 18 34281998 small insertion probably benign
FR4737:Apc UTSW 18 34281999 small insertion probably benign
FR4976:Apc UTSW 18 34281998 small insertion probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably benign
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 missense probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTGTTACAGTCATTCACTC -3'
(R):5'- TGGGATCTAATACCAACTTGAGG -3'

Sequencing Primer
(F):5'- TACTCAGCAAATGCAGGTGTC -3'
(R):5'- GTAACTGAACTGAATTGTGGGAC -3'
Posted OnApr 05, 2018