Incidental Mutation 'FR4976:Las1l'
ID 511996
Institutional Source Beutler Lab
Gene Symbol Las1l
Ensembl Gene ENSMUSG00000057421
Gene Name LAS1-like (S. cerevisiae)
Synonyms 1810030A06Rik, 5830482G23Rik
Accession Numbers
Essential gene? Not available question?
Stock # FR4976 ()
Quality Score 204.468
Status Not validated
Chromosome X
Chromosomal Location 94978941-95000568 bp(-) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) A to AGGC at 94984439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079987] [ENSMUST00000113864]
AlphaFold A2BE28
Predicted Effect probably benign
Transcript: ENSMUST00000079987
SMART Domains Protein: ENSMUSP00000078901
Gene: ENSMUSG00000057421

DomainStartEndE-ValueType
Pfam:Las1 27 173 1e-45 PFAM
low complexity region 183 205 N/A INTRINSIC
coiled coil region 522 609 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113864
SMART Domains Protein: ENSMUSP00000109495
Gene: ENSMUSG00000057421

DomainStartEndE-ValueType
Pfam:Las1 28 172 6e-45 PFAM
low complexity region 183 205 N/A INTRINSIC
coiled coil region 539 626 N/A INTRINSIC
low complexity region 741 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137659
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 220 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,634,881 (GRCm39) probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,257 (GRCm39) probably benign Het
Akap12 AAA AAACAA 10: 4,303,837 (GRCm39) probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,062,425 (GRCm39) probably null Homo
Alg9 G GCGA 9: 50,686,731 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,162,544 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,415,053 (GRCm39) probably benign Het
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,415,057 (GRCm39) probably null Het
Atad3a C A 4: 155,838,396 (GRCm39) R207L probably damaging Homo
Blm ACCT ACCTCCCT 7: 80,113,515 (GRCm39) probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,655 (GRCm39) probably benign Het
Bmp5 GAGGAGT G 9: 75,683,657 (GRCm39) probably benign Homo
Bpifa6 A T 2: 153,828,296 (GRCm39) Q134L probably benign Homo
Bpifa6 A T 2: 153,828,318 (GRCm39) R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,814,755 (GRCm39) probably benign Homo
Cacna1a ACC ACCGCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1a ACC ACCTCC 8: 85,365,355 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,129,701 (GRCm39) probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,228,023 (GRCm39) probably benign Homo
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,228,276 (GRCm39) probably benign Het
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,228,260 (GRCm39) probably benign Homo
Ccdc170 ACC ACCGCC 10: 4,511,023 (GRCm39) probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,511,008 (GRCm39) probably benign Het
Ccdc170 AC ACCTC 10: 4,511,029 (GRCm39) probably benign Het
Ccnk TTCCCAC T 12: 108,168,766 (GRCm39) probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,152,939 (GRCm39) probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,152,941 (GRCm39) probably benign Het
Cep112 G GCTCT 11: 108,316,178 (GRCm39) probably benign Het
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,218,846 (GRCm39) probably benign Homo
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,346 (GRCm39) probably benign Het
Cnpy3 CCT CCTACT 17: 47,047,673 (GRCm39) probably null Het
Cntnap1 A ACCCCCC 11: 101,080,395 (GRCm39) probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,080,414 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,411 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,080,398 (GRCm39) probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,696,627 (GRCm39) probably null Het
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm AGTG AGTGGGTG 13: 61,685,650 (GRCm39) probably null Homo
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,466 (GRCm39) probably benign Het
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,460 (GRCm39) probably benign Het
Cul9 TCC TCCGCC 17: 46,811,776 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,779 (GRCm39) probably benign Het
Cul9 TCC TCCCCC 17: 46,811,782 (GRCm39) probably benign Het
Cul9 CTTC CTTCTTC 17: 46,811,774 (GRCm39) probably benign Het
Cybrd1 GAAT G 2: 70,968,855 (GRCm39) probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,742 (GRCm39) probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,465,745 (GRCm39) probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,465,754 (GRCm39) probably benign Het
Dbr1 GG GGAGGAAG 9: 99,465,755 (GRCm39) probably benign Het
Dcaf8 C T 1: 172,000,423 (GRCm39) H194Y probably damaging Homo
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Homo
Dennd10 T TTCA 19: 60,803,060 (GRCm39) probably benign Homo
Dnaaf9 C CTCG 2: 130,612,673 (GRCm39) probably benign Het
Dnaaf9 TCC TCCCCC 2: 130,612,659 (GRCm39) probably benign Het
Dnaaf9 TCC TCCACC 2: 130,612,662 (GRCm39) probably benign Het
Dnajc19 AC ACGC 3: 34,112,143 (GRCm39) probably null Het
Dthd1 GAC GACTAC 5: 63,000,367 (GRCm39) probably benign Homo
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TC TCTAC 2: 57,938,100 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,092 (GRCm39) probably benign Het
Fbxo38 TGCAGC TGC 18: 62,648,418 (GRCm39) probably benign Het
Frem3 CT CTTGT 8: 81,341,870 (GRCm39) probably benign Homo
Fsip2 TT TTTTTCT 2: 82,814,709 (GRCm39) probably benign Het
Fsip2 TTTTT TTTTTGTTTT 2: 82,814,706 (GRCm39) probably benign Het
Gabre T TGAGGCC X: 71,314,028 (GRCm39) probably benign Homo
Gabre AGGCT AGGCTGCGGCT X: 71,314,024 (GRCm39) probably benign Homo
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Homo
Gm14393 T G 2: 174,903,613 (GRCm39) N98T probably benign Het
Gm16503 G A 4: 147,625,710 (GRCm39) G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,255,061 (GRCm39) probably benign Homo
Gm4340 AGC AGCCGC 10: 104,031,940 (GRCm39) probably benign Het
Gm6309 C T 5: 146,104,993 (GRCm39) V307I probably benign Het
Golga5 G A 12: 102,441,919 (GRCm39) probably null Homo
Gpatch11 AGGAA AGGAAGTGGAA 17: 79,149,609 (GRCm39) probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 79,149,602 (GRCm39) probably null Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 79,149,601 (GRCm39) probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 79,149,600 (GRCm39) probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 79,149,599 (GRCm39) probably benign Het
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 118,112,344 (GRCm39) probably benign Homo
Hoxa10 T A 6: 52,211,166 (GRCm39) Q250L possibly damaging Homo
Igf1r C CTGGAGATGGAGA 7: 67,875,934 (GRCm39) probably benign Het
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 67,875,929 (GRCm39) probably benign Het
Il17rd CGG CGGTGG 14: 26,804,634 (GRCm39) probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,179,978 (GRCm39) probably benign Het
Ipo9 TCC TCCCCC 1: 135,314,019 (GRCm39) probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,510,469 (GRCm39) probably benign Het
Irag2 CACATTG CACATTGAGGACATTG 6: 145,119,511 (GRCm39) probably benign Homo
Isg20l2 AAG AAGTAG 3: 87,839,022 (GRCm39) probably null Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,285,789 (GRCm39) probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,285,791 (GRCm39) probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,285,798 (GRCm39) probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,785 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,285,787 (GRCm39) probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,520,761 (GRCm39) probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,488,830 (GRCm39) probably benign Homo
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,357,854 (GRCm39) probably benign Het
Lrit3 CATA CATAAATA 3: 129,597,559 (GRCm39) probably benign Homo
Mamld1 GCAACA GCAACAACA X: 70,162,418 (GRCm39) probably benign Het
Mamld1 GCA GCAACA X: 70,162,424 (GRCm39) probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,875,755 (GRCm39) probably null Homo
Mast4 TGG TGGGGGCGG 13: 102,872,820 (GRCm39) probably benign Het
Med12l GCA GCACCA 3: 59,183,398 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,568 (GRCm39) probably benign Het
Morf4l2 T C X: 135,634,371 (GRCm39) K286E probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,067,587 (GRCm39) probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,549,756 (GRCm39) probably benign Het
Nacad A ACCAGGG 11: 6,549,749 (GRCm39) probably benign Het
Nacad C CAGGGTA 11: 6,549,763 (GRCm39) probably benign Het
Nars1 CCACTCAC CCAC 18: 64,643,516 (GRCm39) probably benign Homo
Ndufc2 C T 7: 97,049,481 (GRCm39) P29L probably damaging Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l CTG CTGGTG 4: 156,324,555 (GRCm39) probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,069,814 (GRCm39) probably benign Het
Or10j2 GGGCTGCTTGTGGCAAT G 1: 173,098,197 (GRCm39) probably null Het
Or51f1e T TTAC 7: 102,747,516 (GRCm39) probably benign Homo
Or51v8 AG AGAGG 7: 103,320,173 (GRCm39) probably benign Homo
Or52b4 A AAACCG 7: 102,184,888 (GRCm39) probably null Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Patl2 GCT GCTTCT 2: 121,956,622 (GRCm39) probably benign Het
Patl2 CTG CTGGTG 2: 121,956,620 (GRCm39) probably benign Het
Patl2 C CTGA 2: 121,956,626 (GRCm39) probably benign Het
Patl2 GC GCTTC 2: 121,956,625 (GRCm39) probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,006,817 (GRCm39) probably benign Homo
Phc1 TG TGCTGCGG 6: 122,300,559 (GRCm39) probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,844,104 (GRCm39) probably benign Het
Pick1 TTC TTCTC 15: 79,140,146 (GRCm39) probably null Homo
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,612,652 (GRCm39) probably null Homo
Pitrm1 TTTTA T 13: 6,610,632 (GRCm39) probably benign Homo
Pogz GTAAT G 3: 94,782,006 (GRCm39) probably benign Het
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Ppp2r5c G T 12: 110,507,172 (GRCm39) probably null Homo
Prag1 CCGC CCGCCGC 8: 36,571,037 (GRCm39) probably benign Homo
Prr13 CTC CTCTTC 15: 102,370,611 (GRCm39) probably benign Homo
Prr13 CACT CACTACT 15: 102,370,606 (GRCm39) probably benign Homo
Ptms TCT TCTCCT 6: 124,891,417 (GRCm39) probably benign Homo
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Homo
Rpa1 TGCTGCC T 11: 75,209,345 (GRCm39) probably benign Het
Rpgrip1 GGA GGATGA 14: 52,386,851 (GRCm39) probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,387,001 (GRCm39) probably benign Het
Rps19 AGCGG AG 7: 24,588,421 (GRCm39) probably benign Homo
Rsf1 G GACC 7: 97,229,116 (GRCm39) probably benign Homo
Serpina3m A G 12: 104,324,882 (GRCm39) probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,384,488 (GRCm39) probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,646,815 (GRCm39) probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,373,060 (GRCm39) probably benign Homo
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,786 (GRCm39) probably benign Het
Six3 CG CGGGG 17: 85,928,799 (GRCm39) probably benign Het
Skint8 C T 4: 111,796,099 (GRCm39) L258F probably benign Homo
Smoc2 AGTT A 17: 14,621,824 (GRCm39) probably benign Homo
Smpx CCCCCA C X: 156,503,920 (GRCm39) probably benign Homo
Snx1 C CTTT 9: 66,012,212 (GRCm39) probably benign Homo
Snx1 TC TCTGC 9: 66,012,211 (GRCm39) probably benign Homo
Sp110 CT CTAAT 1: 85,515,210 (GRCm39) probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 (GRCm39) probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 (GRCm39) probably benign Het
Spag17 GGA GGACGA 3: 99,963,571 (GRCm39) probably benign Het
Spag17 AGG AGGTGG 3: 99,963,570 (GRCm39) probably benign Het
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 (GRCm39) probably benign Homo
Stard8 AGG AGGTGG X: 98,110,119 (GRCm39) probably benign Het
Stard8 AGG AGGTGG X: 98,110,131 (GRCm39) probably benign Het
Stk10 CCCA C 11: 32,564,520 (GRCm39) probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,424,673 (GRCm39) probably benign Homo
Tbc1d5 G C 17: 51,106,959 (GRCm39) H532Q probably benign Homo
Tbc1d5 C G 17: 51,106,971 (GRCm39) Q528H probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tmcc1 G A 6: 116,170,341 (GRCm39) probably benign Homo
Tob1 AGC AGCCGC 11: 94,105,298 (GRCm39) probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,562,756 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,887,214 (GRCm39) probably benign Homo
Trim16 GTGA GTGATGA 11: 62,711,515 (GRCm39) probably benign Homo
Tsbp1 AGC AGCGGC 17: 34,679,032 (GRCm39) probably benign Het
Tsbp1 AGC AGCGGC 17: 34,679,035 (GRCm39) probably benign Het
Tsen2 AGG AGGCGG 6: 115,537,027 (GRCm39) probably benign Homo
Ubtf TC TCCGC 11: 102,197,785 (GRCm39) probably benign Het
Vmn1r124 G T 7: 20,993,861 (GRCm39) Q228K possibly damaging Het
Vmn1r71 A C 7: 10,482,048 (GRCm39) S147R probably benign Homo
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Homo
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,862,564 (GRCm39) probably benign Homo
Zfp111 T G 7: 23,898,462 (GRCm39) K383T probably damaging Homo
Zfp111 A ATCG 7: 23,899,232 (GRCm39) probably benign Homo
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,881,724 (GRCm39) probably benign Het
Zfp335 TCC TCCACC 2: 164,749,398 (GRCm39) probably benign Het
Zfp335 CTC CTCTTC 2: 164,749,394 (GRCm39) probably benign Het
Zfp459 A AGTGG 13: 67,556,395 (GRCm39) probably null Homo
Zfp459 TGA TGAGAGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp459 GA GAGTTA 13: 67,556,394 (GRCm39) probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 (GRCm39) probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 (GRCm39) probably benign Het
Zfp598 CCACAGGC CC 17: 24,898,346 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,756 (GRCm39) probably benign Het
Zfp683 AG AGGGG 4: 133,786,190 (GRCm39) probably benign Homo
Zpld2 TG TGCCG 4: 133,929,941 (GRCm39) probably benign Homo
Other mutations in Las1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Las1l APN X 94,981,059 (GRCm39) missense probably benign 0.04
IGL02152:Las1l APN X 94,996,908 (GRCm39) missense probably damaging 1.00
IGL02864:Las1l APN X 94,991,446 (GRCm39) missense possibly damaging 0.78
FR4304:Las1l UTSW X 94,984,427 (GRCm39) small insertion probably benign
FR4304:Las1l UTSW X 94,984,426 (GRCm39) small insertion probably benign
FR4340:Las1l UTSW X 94,984,228 (GRCm39) small insertion probably benign
FR4449:Las1l UTSW X 94,984,438 (GRCm39) small insertion probably benign
FR4548:Las1l UTSW X 94,984,429 (GRCm39) small insertion probably benign
FR4548:Las1l UTSW X 94,984,231 (GRCm39) small insertion probably benign
FR4589:Las1l UTSW X 94,984,231 (GRCm39) small insertion probably benign
FR4589:Las1l UTSW X 94,984,227 (GRCm39) small deletion probably benign
FR4589:Las1l UTSW X 94,984,225 (GRCm39) small insertion probably benign
FR4737:Las1l UTSW X 94,984,435 (GRCm39) small insertion probably benign
FR4737:Las1l UTSW X 94,984,433 (GRCm39) small insertion probably benign
FR4737:Las1l UTSW X 94,984,427 (GRCm39) small insertion probably benign
FR4976:Las1l UTSW X 94,984,438 (GRCm39) small insertion probably benign
FR4976:Las1l UTSW X 94,984,433 (GRCm39) small insertion probably benign
R1400:Las1l UTSW X 94,990,506 (GRCm39) missense possibly damaging 0.88
RF003:Las1l UTSW X 94,984,422 (GRCm39) small insertion probably benign
RF008:Las1l UTSW X 94,984,422 (GRCm39) small insertion probably benign
RF014:Las1l UTSW X 94,984,263 (GRCm39) small deletion probably benign
RF025:Las1l UTSW X 94,984,226 (GRCm39) nonsense probably null
RF042:Las1l UTSW X 94,984,226 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTGTGCAAGAGAGAAGG -3'
(R):5'- CTCCAGAGTGTTGAGCTATGAG -3'

Sequencing Primer
(F):5'- GCCTCCATCTGATCTTGAAAGAC -3'
(R):5'- TCCAGAGTGTTGAGCTATGAGGTAAC -3'
Posted On 2018-04-05