Incidental Mutation 'FR4548:Ahdc1'
ID 512029
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene Name AT hook, DNA binding motif, containing 1
Synonyms D030015G18Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.189) question?
Stock # FR4548 ()
Quality Score 214.458
Status Not validated
Chromosome 4
Chromosomal Location 132738797-132805421 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) T to TCCC at 132790071 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
AlphaFold Q6PAL7
Predicted Effect probably benign
Transcript: ENSMUST00000044521
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105914
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105915
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105916
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 146 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,634,886 (GRCm39) probably benign Het
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
AI837181 CGG CGGGGG 19: 5,475,259 (GRCm39) probably benign Het
AI837181 CG CGGGG 19: 5,475,265 (GRCm39) probably benign Het
Anxa2 CCC CCCTCC 9: 69,387,485 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apol6 T TGTTA 15: 76,935,645 (GRCm39) probably null Homo
Blm CTAC CTACTTAC 7: 80,113,517 (GRCm39) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Bud31 C T 5: 145,083,345 (GRCm39) R63C probably benign Het
C4b C T 17: 34,959,971 (GRCm39) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1f AGG AGGGGG X: 7,486,297 (GRCm39) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,511,026 (GRCm39) probably benign Het
Cckbr GGGC G 7: 105,083,888 (GRCm39) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,306,681 (GRCm39) probably benign Homo
Ces1b T C 8: 93,794,720 (GRCm39) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,631,999 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,080,420 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,405 (GRCm39) probably benign Het
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Ctsm GTGA GTGAATGA 13: 61,685,651 (GRCm39) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,726 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,241,729 (GRCm39) probably benign Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TTC TTCATC 2: 57,938,087 (GRCm39) probably benign Het
Ermn TC TCTCC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,244 (GRCm39) probably null Het
Fscb T A 12: 64,519,339 (GRCm39) Q709L unknown Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Glod4 A C 11: 76,134,136 (GRCm39) probably benign Homo
Gm14401 A G 2: 176,778,661 (GRCm39) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,934 (GRCm39) probably benign Het
Gm4340 AGC AGCCGC 10: 104,031,931 (GRCm39) probably benign Het
Gm8104 T C 14: 42,967,468 (GRCm39) S179P probably damaging Het
Gm8104 C T 14: 42,967,466 (GRCm39) T178I probably benign Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 79,149,604 (GRCm39) probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Ifi211 G A 1: 173,733,759 (GRCm39) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 67,875,934 (GRCm39) probably benign Het
Igkv9-129 G A 6: 67,817,018 (GRCm39) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,314,013 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,198,814 (GRCm39) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,285,805 (GRCm39) probably benign Het
Kng2 G A 16: 22,819,302 (GRCm39) Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,192,346 (GRCm39) probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,280,102 (GRCm39) probably benign Homo
Las1l TC TCTTCCGC X: 94,984,231 (GRCm39) probably benign Het
Las1l GAG GAGAAG X: 94,984,429 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,462 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,465 (GRCm39) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,270,499 (GRCm39) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,872,826 (GRCm39) probably benign Homo
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Mn1 GCA GCACCA 5: 111,567,564 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,067,582 (GRCm39) probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,067,583 (GRCm39) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,549,752 (GRCm39) probably benign Het
Nacad GG GGCCAGTG 11: 6,549,760 (GRCm39) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,150,559 (GRCm39) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 35,073,046 (GRCm39) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,716,458 (GRCm39) probably benign Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l GC GCTTC 4: 156,324,557 (GRCm39) probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,119,228 (GRCm39) probably benign Homo
Or2ak5 T G 11: 58,611,197 (GRCm39) I226L probably benign Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Homo
Or51v8 G GAAC 7: 103,320,174 (GRCm39) probably null Homo
Or51v8 CAAA CAAAAAA 7: 103,320,167 (GRCm39) probably benign Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Osmr CTC CTCTTC 15: 6,867,184 (GRCm39) probably benign Homo
Patl2 GCT GCTCCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,006,823 (GRCm39) probably benign Homo
Phldb3 GACCC G 7: 24,328,403 (GRCm39) probably null Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Polr1g GGATG GG 7: 19,091,169 (GRCm39) probably benign Homo
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,571,039 (GRCm39) probably benign Homo
Prr13 TCC TCCGCC 15: 102,370,609 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Homo
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,891,419 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,599,199 (GRCm39) probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,384,485 (GRCm39) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,646,819 (GRCm39) probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,373,064 (GRCm39) probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,373,065 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GGC GGCCGC 17: 85,928,791 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 124,996,134 (GRCm39) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,570 (GRCm39) probably benign Het
Spata31h1 G GTCATTA 10: 82,126,830 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Supt20 CA CAGCAGAA 3: 54,635,094 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,078 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,085 (GRCm39) probably benign Het
Syne1 C A 10: 4,982,969 (GRCm39) S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,105,281 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,295 (GRCm39) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm39) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Het
Triobp TCG TCGCCG 15: 78,877,590 (GRCm39) probably benign Homo
Triobp TCG TCGGCG 15: 78,877,587 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,039 (GRCm39) probably benign Het
Tsen2 GAG GAGAAG 6: 115,537,029 (GRCm39) probably benign Het
Ttf2 TC TCCGC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,223,540 (GRCm39) probably benign Het
Ubtf CTC CTCATC 11: 102,197,784 (GRCm39) probably benign Het
Utrn T TTCCTGTC 10: 12,509,685 (GRCm39) probably benign Homo
Vars1 TGG TGGAGTCCTGGGGGG 17: 35,234,965 (GRCm39) probably benign Homo
Vars1 G GAGTCCTGGGTGC 17: 35,234,967 (GRCm39) probably benign Het
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,561,039 (GRCm39) probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,930,607 (GRCm39) probably null Het
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,749,392 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Zfp986 G T 4: 145,625,928 (GRCm39) R196I probably benign Het
Zfp992 G T 4: 146,550,464 (GRCm39) E62* probably null Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 132,790,373 (GRCm39) missense probably benign 0.33
IGL02293:Ahdc1 APN 4 132,792,929 (GRCm39) missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 132,789,860 (GRCm39) missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 132,790,232 (GRCm39) missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 132,790,004 (GRCm39) missense probably damaging 0.99
IGL02859:Ahdc1 APN 4 132,790,003 (GRCm39) missense possibly damaging 0.53
IGL02901:Ahdc1 APN 4 132,792,245 (GRCm39) missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 132,792,739 (GRCm39) missense probably benign
FR4304:Ahdc1 UTSW 4 132,790,070 (GRCm39) small insertion probably benign
FR4548:Ahdc1 UTSW 4 132,790,068 (GRCm39) small insertion probably benign
FR4737:Ahdc1 UTSW 4 132,790,070 (GRCm39) small insertion probably benign
R0325:Ahdc1 UTSW 4 132,790,030 (GRCm39) missense unknown
R0550:Ahdc1 UTSW 4 132,790,348 (GRCm39) missense probably benign 0.33
R0681:Ahdc1 UTSW 4 132,792,827 (GRCm39) missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 132,792,827 (GRCm39) missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 132,790,262 (GRCm39) missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 132,792,707 (GRCm39) missense probably benign 0.02
R1137:Ahdc1 UTSW 4 132,789,424 (GRCm39) missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 132,792,707 (GRCm39) missense probably benign 0.02
R1331:Ahdc1 UTSW 4 132,791,002 (GRCm39) missense probably benign 0.18
R1599:Ahdc1 UTSW 4 132,792,247 (GRCm39) missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 132,793,220 (GRCm39) missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 132,793,220 (GRCm39) missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 132,790,474 (GRCm39) missense unknown
R2262:Ahdc1 UTSW 4 132,790,474 (GRCm39) missense unknown
R3683:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 132,793,013 (GRCm39) missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 132,793,297 (GRCm39) missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 132,791,476 (GRCm39) missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 132,791,624 (GRCm39) missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 132,791,631 (GRCm39) missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 132,790,833 (GRCm39) missense probably benign 0.18
R5276:Ahdc1 UTSW 4 132,790,109 (GRCm39) missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 132,792,907 (GRCm39) missense probably benign
R5997:Ahdc1 UTSW 4 132,791,206 (GRCm39) missense probably benign 0.05
R6050:Ahdc1 UTSW 4 132,793,202 (GRCm39) missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 132,792,035 (GRCm39) missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 132,790,210 (GRCm39) missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 132,792,079 (GRCm39) missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 132,789,656 (GRCm39) missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 132,791,935 (GRCm39) missense probably benign 0.33
R7202:Ahdc1 UTSW 4 132,789,198 (GRCm39) nonsense probably null
R7576:Ahdc1 UTSW 4 132,792,313 (GRCm39) missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 132,790,825 (GRCm39) missense probably benign 0.18
R7794:Ahdc1 UTSW 4 132,791,289 (GRCm39) missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 132,791,161 (GRCm39) missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 132,790,226 (GRCm39) missense possibly damaging 0.96
R8295:Ahdc1 UTSW 4 132,788,762 (GRCm39) start codon destroyed probably null 0.53
R8332:Ahdc1 UTSW 4 132,791,282 (GRCm39) missense possibly damaging 0.85
R8719:Ahdc1 UTSW 4 132,791,533 (GRCm39) missense possibly damaging 0.86
R8725:Ahdc1 UTSW 4 132,792,743 (GRCm39) missense possibly damaging 0.86
R8862:Ahdc1 UTSW 4 132,791,129 (GRCm39) missense possibly damaging 0.53
R9158:Ahdc1 UTSW 4 132,792,505 (GRCm39) missense possibly damaging 0.53
R9179:Ahdc1 UTSW 4 132,788,929 (GRCm39) missense possibly damaging 0.93
R9362:Ahdc1 UTSW 4 132,790,348 (GRCm39) missense probably benign 0.33
R9428:Ahdc1 UTSW 4 132,791,773 (GRCm39) missense possibly damaging 0.93
RF017:Ahdc1 UTSW 4 132,790,062 (GRCm39) small insertion probably benign
RF020:Ahdc1 UTSW 4 132,791,588 (GRCm39) missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 132,790,065 (GRCm39) small insertion probably benign
T0975:Ahdc1 UTSW 4 132,790,065 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTGCTCACCTCATGG -3'
(R):5'- CTGCTGCTCAAGGATGAAACTTTG -3'

Sequencing Primer
(F):5'- ACCTCATGGTCCCCCTGG -3'
(R):5'- CTCAAGGATGAAACTTTGTACGTGG -3'
Posted On 2018-04-05