Incidental Mutation 'FR4548:Tsen2'
ID 512045
Institutional Source Beutler Lab
Gene Symbol Tsen2
Ensembl Gene ENSMUSG00000042389
Gene Name tRNA splicing endonuclease subunit 2
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # FR4548 ()
Quality Score 206.733
Status Not validated
Chromosome 6
Chromosomal Location 115521652-115555297 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GAG to GAGAAG at 115537029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040234]
AlphaFold Q6P7W5
Predicted Effect probably benign
Transcript: ENSMUST00000040234
SMART Domains Protein: ENSMUSP00000038211
Gene: ENSMUSG00000042389

DomainStartEndE-ValueType
Blast:HOLI 1 55 2e-23 BLAST
Pfam:tRNA_int_endo_N 258 324 9.9e-16 PFAM
Pfam:tRNA_int_endo 334 426 5.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123359
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,634,886 (GRCm39) probably benign Het
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
Ahdc1 T TCCC 4: 132,790,071 (GRCm39) probably benign Homo
Ahdc1 TCC TCCCCC 4: 132,790,068 (GRCm39) probably benign Homo
AI837181 CGG CGGGGG 19: 5,475,259 (GRCm39) probably benign Het
AI837181 CG CGGGG 19: 5,475,265 (GRCm39) probably benign Het
Anxa2 CCC CCCTCC 9: 69,387,485 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apol6 T TGTTA 15: 76,935,645 (GRCm39) probably null Homo
Blm CTAC CTACTTAC 7: 80,113,517 (GRCm39) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Bud31 C T 5: 145,083,345 (GRCm39) R63C probably benign Het
C4b C T 17: 34,959,971 (GRCm39) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1f AGG AGGGGG X: 7,486,297 (GRCm39) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,511,026 (GRCm39) probably benign Het
Cckbr GGGC G 7: 105,083,888 (GRCm39) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,306,681 (GRCm39) probably benign Homo
Ces1b T C 8: 93,794,720 (GRCm39) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,631,999 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,080,420 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,405 (GRCm39) probably benign Het
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm GTGA GTGAATGA 13: 61,685,651 (GRCm39) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,726 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,241,729 (GRCm39) probably benign Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TTC TTCATC 2: 57,938,087 (GRCm39) probably benign Het
Ermn TC TCTCC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,244 (GRCm39) probably null Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Fscb T A 12: 64,519,339 (GRCm39) Q709L unknown Het
Glod4 A C 11: 76,134,136 (GRCm39) probably benign Homo
Gm14401 A G 2: 176,778,661 (GRCm39) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,934 (GRCm39) probably benign Het
Gm4340 AGC AGCCGC 10: 104,031,931 (GRCm39) probably benign Het
Gm8104 T C 14: 42,967,468 (GRCm39) S179P probably damaging Het
Gm8104 C T 14: 42,967,466 (GRCm39) T178I probably benign Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 79,149,604 (GRCm39) probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Ifi211 G A 1: 173,733,759 (GRCm39) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 67,875,934 (GRCm39) probably benign Het
Igkv9-129 G A 6: 67,817,018 (GRCm39) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,314,013 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,198,814 (GRCm39) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,285,805 (GRCm39) probably benign Het
Kng2 G A 16: 22,819,302 (GRCm39) Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,192,346 (GRCm39) probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,280,102 (GRCm39) probably benign Homo
Las1l TC TCTTCCGC X: 94,984,231 (GRCm39) probably benign Het
Las1l GAG GAGAAG X: 94,984,429 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,462 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,465 (GRCm39) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,270,499 (GRCm39) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,872,826 (GRCm39) probably benign Homo
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Mn1 GCA GCACCA 5: 111,567,564 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,067,582 (GRCm39) probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,067,583 (GRCm39) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,549,752 (GRCm39) probably benign Het
Nacad GG GGCCAGTG 11: 6,549,760 (GRCm39) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,150,559 (GRCm39) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 35,073,046 (GRCm39) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,716,458 (GRCm39) probably benign Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l GC GCTTC 4: 156,324,557 (GRCm39) probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,119,228 (GRCm39) probably benign Homo
Or2ak5 T G 11: 58,611,197 (GRCm39) I226L probably benign Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Homo
Or51v8 G GAAC 7: 103,320,174 (GRCm39) probably null Homo
Or51v8 CAAA CAAAAAA 7: 103,320,167 (GRCm39) probably benign Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Osmr CTC CTCTTC 15: 6,867,184 (GRCm39) probably benign Homo
Patl2 GCT GCTCCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,006,823 (GRCm39) probably benign Homo
Phldb3 GACCC G 7: 24,328,403 (GRCm39) probably null Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Polr1g GGATG GG 7: 19,091,169 (GRCm39) probably benign Homo
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,571,039 (GRCm39) probably benign Homo
Prr13 TCC TCCGCC 15: 102,370,609 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Homo
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,891,419 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,599,199 (GRCm39) probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,384,485 (GRCm39) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,646,819 (GRCm39) probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,373,064 (GRCm39) probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,373,065 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GGC GGCCGC 17: 85,928,791 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 124,996,134 (GRCm39) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,570 (GRCm39) probably benign Het
Spata31h1 G GTCATTA 10: 82,126,830 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Supt20 CA CAGCAGAA 3: 54,635,094 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,078 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,085 (GRCm39) probably benign Het
Syne1 C A 10: 4,982,969 (GRCm39) S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,105,281 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,295 (GRCm39) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm39) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Het
Triobp TCG TCGCCG 15: 78,877,590 (GRCm39) probably benign Homo
Triobp TCG TCGGCG 15: 78,877,587 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,039 (GRCm39) probably benign Het
Ttf2 TC TCCGC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,223,540 (GRCm39) probably benign Het
Ubtf CTC CTCATC 11: 102,197,784 (GRCm39) probably benign Het
Utrn T TTCCTGTC 10: 12,509,685 (GRCm39) probably benign Homo
Vars1 TGG TGGAGTCCTGGGGGG 17: 35,234,965 (GRCm39) probably benign Homo
Vars1 G GAGTCCTGGGTGC 17: 35,234,967 (GRCm39) probably benign Het
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,561,039 (GRCm39) probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,930,607 (GRCm39) probably null Het
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,749,392 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Zfp986 G T 4: 145,625,928 (GRCm39) R196I probably benign Het
Zfp992 G T 4: 146,550,464 (GRCm39) E62* probably null Het
Other mutations in Tsen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tsen2 APN 6 115,553,945 (GRCm39) missense probably damaging 1.00
IGL01409:Tsen2 APN 6 115,536,555 (GRCm39) missense possibly damaging 0.72
IGL02002:Tsen2 APN 6 115,536,568 (GRCm39) missense probably benign 0.12
IGL03301:Tsen2 APN 6 115,545,732 (GRCm39) missense probably damaging 1.00
FR4304:Tsen2 UTSW 6 115,537,030 (GRCm39) small insertion probably benign
FR4340:Tsen2 UTSW 6 115,537,030 (GRCm39) small insertion probably benign
FR4340:Tsen2 UTSW 6 115,537,027 (GRCm39) small insertion probably benign
FR4342:Tsen2 UTSW 6 115,537,033 (GRCm39) small insertion probably benign
FR4737:Tsen2 UTSW 6 115,537,038 (GRCm39) small insertion probably benign
FR4976:Tsen2 UTSW 6 115,537,027 (GRCm39) small insertion probably benign
R0141:Tsen2 UTSW 6 115,545,790 (GRCm39) missense probably damaging 0.99
R1165:Tsen2 UTSW 6 115,538,396 (GRCm39) missense probably damaging 1.00
R1528:Tsen2 UTSW 6 115,536,989 (GRCm39) missense probably benign 0.01
R2152:Tsen2 UTSW 6 115,524,936 (GRCm39) missense possibly damaging 0.94
R4022:Tsen2 UTSW 6 115,524,948 (GRCm39) missense probably damaging 1.00
R4246:Tsen2 UTSW 6 115,524,785 (GRCm39) splice site probably benign
R4247:Tsen2 UTSW 6 115,524,785 (GRCm39) splice site probably benign
R4249:Tsen2 UTSW 6 115,524,785 (GRCm39) splice site probably benign
R4774:Tsen2 UTSW 6 115,552,894 (GRCm39) missense possibly damaging 0.92
R5511:Tsen2 UTSW 6 115,538,365 (GRCm39) missense probably damaging 1.00
R5580:Tsen2 UTSW 6 115,554,941 (GRCm39) missense probably damaging 1.00
R5935:Tsen2 UTSW 6 115,536,556 (GRCm39) missense probably damaging 1.00
R6086:Tsen2 UTSW 6 115,537,036 (GRCm39) missense probably benign 0.35
R6457:Tsen2 UTSW 6 115,536,592 (GRCm39) missense probably benign 0.01
R6750:Tsen2 UTSW 6 115,526,881 (GRCm39) missense probably damaging 1.00
R7009:Tsen2 UTSW 6 115,524,933 (GRCm39) missense possibly damaging 0.94
R7438:Tsen2 UTSW 6 115,536,943 (GRCm39) nonsense probably null
R9254:Tsen2 UTSW 6 115,553,864 (GRCm39) missense probably damaging 0.97
RF030:Tsen2 UTSW 6 115,537,028 (GRCm39) small insertion probably benign
RF035:Tsen2 UTSW 6 115,537,028 (GRCm39) small insertion probably benign
RF042:Tsen2 UTSW 6 115,537,028 (GRCm39) small insertion probably benign
RF056:Tsen2 UTSW 6 115,537,025 (GRCm39) small insertion probably benign
Z1176:Tsen2 UTSW 6 115,536,877 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGACAGTCAGATGACCTACCC -3'
(R):5'- TCCTAACACTGCAATGAGAGC -3'

Sequencing Primer
(F):5'- GTCTCGGCACACACTCAG -3'
(R):5'- GCAATAAGGAATGTGGGCTCTC -3'
Posted On 2018-04-05