Incidental Mutation 'FR4548:Cacna1a'
List |< first << previous [record 94 of 1113] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #FR4548 ()
Quality Score217.468
Status Not validated
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) ACC to ACCCCC at 84638717 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably benign
Transcript: ENSMUST00000121390
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122053
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144879
Predicted Effect probably benign
Transcript: ENSMUST00000215756
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,668,452 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4932415D10Rik G GTCATTA 10: 82,290,996 probably benign Homo
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
Ahdc1 TCC TCCCCC 4: 133,062,757 probably benign Homo
Ahdc1 T TCCC 4: 133,062,760 probably benign Homo
AI837181 CGG CGGGGG 19: 5,425,231 probably benign Het
AI837181 CG CGGGG 19: 5,425,237 probably benign Het
Anxa2 CCC CCCTCC 9: 69,480,203 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,281,998 probably benign Het
Apol6 T TGTTA 15: 77,051,445 probably null Homo
BC051142 GCA GCATCA 17: 34,460,065 probably benign Het
Blm CTAC CTACTTAC 7: 80,463,769 probably null Homo
Bud31 C T 5: 145,146,535 R63C probably benign Het
C4b C T 17: 34,740,997 R335H probably benign Het
Cacna1f AGG AGGGGG X: 7,620,058 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cckbr GGGC G 7: 105,434,681 probably benign Homo
Cd3eap GGATG GG 7: 19,357,244 probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,486,319 probably benign Homo
Ces1b T C 8: 93,068,092 N293S probably benign Homo
Cgnl1 CGC CGCGGC 9: 71,724,717 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,579 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,189,594 probably benign Het
Ctsm GTGA GTGAATGA 13: 61,537,837 probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,463 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,673 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,334,422 probably benign Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn TTC TTCATC 2: 58,048,075 probably benign Het
Ermn TC TCTCC 2: 58,048,088 probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,098 probably null Het
Fscb A G 12: 64,472,563 S710P unknown Het
Fscb T A 12: 64,472,565 Q709L unknown Het
Glod4 A C 11: 76,243,310 probably benign Homo
Gm14401 A G 2: 177,086,868 D249G probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,070 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,073 probably benign Het
Gm8104 C T 14: 43,110,009 T178I probably benign Het
Gm8104 T C 14: 43,110,011 S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 78,842,175 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Ifi211 G A 1: 173,906,193 A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 68,226,186 probably benign Het
Igkv9-129 G A 6: 67,840,034 V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,386,275 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,221,851 probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,586,380 probably benign Het
Kng2 G A 16: 23,000,552 Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,281,050 probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,389,273 probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,389,276 probably benign Homo
Las1l TC TCTTCCGC X: 95,940,625 probably benign Het
Las1l GAG GAGAAG X: 95,940,823 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,813 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,816 probably benign Het
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,543,188 probably benign Homo
Mast4 CA CAGTGGGA 13: 102,736,318 probably benign Homo
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Mn1 GCA GCACCA 5: 111,419,698 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,076,109 probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,149,345 probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,149,346 probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,599,752 probably benign Het
Nacad GG GGCCAGTG 11: 6,599,760 probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,173,596 probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,559,115 probably benign Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l GC GCTTC 4: 156,240,100 probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 TTG TTGACACTG 14: 38,397,271 probably benign Homo
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr318 T G 11: 58,720,371 I226L probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Homo
Olfr624 CAAA CAAAAAA 7: 103,670,960 probably benign Homo
Olfr624 G GAAC 7: 103,670,967 probably null Homo
Osmr CTC CTCTTC 15: 6,837,703 probably benign Homo
Patl2 GCT GCTCCT 2: 122,126,135 probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,279,512 probably benign Homo
Phldb3 GACCC G 7: 24,628,978 probably null Het
Piezo1 G A 8: 122,495,569 R942W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,103,885 probably benign Homo
Prr13 TCC TCCGCC 15: 102,462,174 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Homo
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,914,456 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,394,201 probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,785,313 probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,569,749 probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,569,755 probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,423,064 probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,423,065 probably benign Het
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GGC GGCCGC 17: 85,621,363 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 125,154,214 probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,254 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,664 probably benign Het
Supt20 CA CAGCAGAA 3: 54,727,673 probably benign Het
Syne1 C A 10: 5,032,969 S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,214,455 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,469 probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Het
Triobp TCG TCGGCG 15: 78,993,387 probably benign Het
Triobp TCG TCGCCG 15: 78,993,390 probably benign Homo
Tsen2 GAG GAGAAG 6: 115,560,068 probably benign Het
Ttf2 TC TCCGC 3: 100,963,160 probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,335,303 probably benign Het
Ubtf CTC CTCATC 11: 102,306,958 probably benign Het
Utrn T TTCCTGTC 10: 12,633,941 probably benign Homo
Vars TGG TGGAGTCCTGGGGGG 17: 35,015,989 probably benign Homo
Vars G GAGTCCTGGGTGC 17: 35,015,991 probably benign Het
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,323,599 probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,942,168 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,907,472 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Zfp986 G T 4: 145,899,358 R196I probably benign Het
Zfp992 G T 4: 146,466,007 E62* probably null Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 unclassified probably benign
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 unclassified probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice acceptor site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably benign
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably benign
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably benign
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 missense probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer

Sequencing Primer
Posted OnApr 05, 2018