Incidental Mutation 'FR4548:Cntnap1'
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #FR4548 ()
Quality Score217.468
Status Not validated
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCC to GCCCCAACC at 101189594 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 144 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,668,452 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4932415D10Rik G GTCATTA 10: 82,290,996 probably benign Homo
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
Ahdc1 TCC TCCCCC 4: 133,062,757 probably benign Homo
Ahdc1 T TCCC 4: 133,062,760 probably benign Homo
AI837181 CGG CGGGGG 19: 5,425,231 probably benign Het
AI837181 CG CGGGG 19: 5,425,237 probably benign Het
Anxa2 CCC CCCTCC 9: 69,480,203 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,281,998 probably benign Het
Apol6 T TGTTA 15: 77,051,445 probably null Homo
BC051142 GCA GCATCA 17: 34,460,065 probably benign Het
Blm CTAC CTACTTAC 7: 80,463,769 probably null Homo
Bud31 C T 5: 145,146,535 R63C probably benign Het
C4b C T 17: 34,740,997 R335H probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,717 probably benign Het
Cacna1f AGG AGGGGG X: 7,620,058 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cckbr GGGC G 7: 105,434,681 probably benign Homo
Cd3eap GGATG GG 7: 19,357,244 probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,486,319 probably benign Homo
Ces1b T C 8: 93,068,092 N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,724,717 probably benign Het
Ctsm GTGA GTGAATGA 13: 61,537,837 probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,463 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,673 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,334,422 probably benign Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn TTC TTCATC 2: 58,048,075 probably benign Het
Ermn TC TCTCC 2: 58,048,088 probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,098 probably null Het
Fscb A G 12: 64,472,563 S710P unknown Het
Fscb T A 12: 64,472,565 Q709L unknown Het
Glod4 A C 11: 76,243,310 probably benign Homo
Gm14401 A G 2: 177,086,868 D249G probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,070 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,073 probably benign Het
Gm8104 C T 14: 43,110,009 T178I probably benign Het
Gm8104 T C 14: 43,110,011 S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 78,842,175 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Ifi211 G A 1: 173,906,193 A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 68,226,186 probably benign Het
Igkv9-129 G A 6: 67,840,034 V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,386,275 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,221,851 probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,586,380 probably benign Het
Kng2 G A 16: 23,000,552 Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,281,050 probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,389,273 probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,389,276 probably benign Homo
Las1l TC TCTTCCGC X: 95,940,625 probably benign Het
Las1l GAG GAGAAG X: 95,940,823 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,813 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,816 probably benign Het
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,543,188 probably benign Homo
Mast4 CA CAGTGGGA 13: 102,736,318 probably benign Homo
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Mn1 GCA GCACCA 5: 111,419,698 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,076,109 probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,149,345 probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,149,346 probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,599,752 probably benign Het
Nacad GG GGCCAGTG 11: 6,599,760 probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,173,596 probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,559,115 probably benign Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l GC GCTTC 4: 156,240,100 probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 TTG TTGACACTG 14: 38,397,271 probably benign Homo
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr318 T G 11: 58,720,371 I226L probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Homo
Olfr624 CAAA CAAAAAA 7: 103,670,960 probably benign Homo
Olfr624 G GAAC 7: 103,670,967 probably null Homo
Osmr CTC CTCTTC 15: 6,837,703 probably benign Homo
Patl2 GCT GCTCCT 2: 122,126,135 probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,279,512 probably benign Homo
Phldb3 GACCC G 7: 24,628,978 probably null Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,103,885 probably benign Homo
Prr13 TCC TCCGCC 15: 102,462,174 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Homo
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,914,456 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,394,201 probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,785,313 probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,569,749 probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,569,755 probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,423,064 probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,423,065 probably benign Het
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GGC GGCCGC 17: 85,621,363 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 125,154,214 probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,254 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,664 probably benign Het
Supt20 CA CAGCAGAA 3: 54,727,673 probably benign Het
Syne1 C A 10: 5,032,969 S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,214,455 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,469 probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Het
Triobp TCG TCGGCG 15: 78,993,387 probably benign Het
Triobp TCG TCGCCG 15: 78,993,390 probably benign Homo
Tsen2 GAG GAGAAG 6: 115,560,068 probably benign Het
Ttf2 TC TCCGC 3: 100,963,160 probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,335,303 probably benign Het
Ubtf CTC CTCATC 11: 102,306,958 probably benign Het
Utrn T TTCCTGTC 10: 12,633,941 probably benign Homo
Vars TGG TGGAGTCCTGGGGGG 17: 35,015,989 probably benign Homo
Vars G GAGTCCTGGGTGC 17: 35,015,991 probably benign Het
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,323,599 probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,942,168 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,907,472 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Zfp986 G T 4: 145,899,358 R196I probably benign Het
Zfp992 G T 4: 146,466,007 E62* probably null Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
PIT4354001:Cntnap1 UTSW 11 101181297 missense probably damaging 1.00
PIT4466001:Cntnap1 UTSW 11 101177305 missense probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 splice site probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
R7152:Cntnap1 UTSW 11 101177326 missense probably damaging 1.00
R7297:Cntnap1 UTSW 11 101188634 missense probably benign 0.01
R7347:Cntnap1 UTSW 11 101185268 missense probably damaging 1.00
R7961:Cntnap1 UTSW 11 101178295 missense probably benign
R7980:Cntnap1 UTSW 11 101188893 missense probably benign
R8307:Cntnap1 UTSW 11 101188876 missense possibly damaging 0.73
R8386:Cntnap1 UTSW 11 101182203 missense probably damaging 1.00
R8403:Cntnap1 UTSW 11 101177590 missense probably damaging 1.00
RF042:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101189563 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189592 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189596 unclassified probably benign
RF050:Cntnap1 UTSW 11 101189592 unclassified probably benign
Z1176:Cntnap1 UTSW 11 101182898 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05