Incidental Mutation 'FR4548:Zc3h13'
ID 512113
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Name zinc finger CCCH type containing 13
Synonyms 3110050K21Rik, C87618, 4930570G11Rik, 2600010B19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # FR4548 ()
Quality Score 217.468
Status Not validated
Chromosome 14
Chromosomal Location 75521813-75581866 bp(+) (GRCm39)
Type of Mutation small insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGCG to TGCGTGATGAGCG at 75561039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold E9Q784
Predicted Effect probably benign
Transcript: ENSMUST00000022577
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226417
Predicted Effect probably benign
Transcript: ENSMUST00000227049
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,634,886 (GRCm39) probably benign Het
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
Ahdc1 TCC TCCCCC 4: 132,790,068 (GRCm39) probably benign Homo
Ahdc1 T TCCC 4: 132,790,071 (GRCm39) probably benign Homo
AI837181 CG CGGGG 19: 5,475,265 (GRCm39) probably benign Het
AI837181 CGG CGGGGG 19: 5,475,259 (GRCm39) probably benign Het
Anxa2 CCC CCCTCC 9: 69,387,485 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apol6 T TGTTA 15: 76,935,645 (GRCm39) probably null Homo
Blm CTAC CTACTTAC 7: 80,113,517 (GRCm39) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Bud31 C T 5: 145,083,345 (GRCm39) R63C probably benign Het
C4b C T 17: 34,959,971 (GRCm39) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1f AGG AGGGGG X: 7,486,297 (GRCm39) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,511,026 (GRCm39) probably benign Het
Cckbr GGGC G 7: 105,083,888 (GRCm39) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,306,681 (GRCm39) probably benign Homo
Ces1b T C 8: 93,794,720 (GRCm39) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,631,999 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,405 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,080,420 (GRCm39) probably benign Het
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Ctsm GTGA GTGAATGA 13: 61,685,651 (GRCm39) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,726 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,241,729 (GRCm39) probably benign Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TC TCTCC 2: 57,938,100 (GRCm39) probably benign Het
Ermn TTC TTCATC 2: 57,938,087 (GRCm39) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,244 (GRCm39) probably null Het
Fscb T A 12: 64,519,339 (GRCm39) Q709L unknown Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Glod4 A C 11: 76,134,136 (GRCm39) probably benign Homo
Gm14401 A G 2: 176,778,661 (GRCm39) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,934 (GRCm39) probably benign Het
Gm4340 AGC AGCCGC 10: 104,031,931 (GRCm39) probably benign Het
Gm8104 C T 14: 42,967,466 (GRCm39) T178I probably benign Het
Gm8104 T C 14: 42,967,468 (GRCm39) S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 79,149,604 (GRCm39) probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Ifi211 G A 1: 173,733,759 (GRCm39) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 67,875,934 (GRCm39) probably benign Het
Igkv9-129 G A 6: 67,817,018 (GRCm39) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,314,013 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,198,814 (GRCm39) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,285,805 (GRCm39) probably benign Het
Kng2 G A 16: 22,819,302 (GRCm39) Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,192,346 (GRCm39) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,280,102 (GRCm39) probably benign Homo
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Las1l TC TCTTCCGC X: 94,984,231 (GRCm39) probably benign Het
Las1l GAG GAGAAG X: 94,984,429 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,462 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,465 (GRCm39) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,270,499 (GRCm39) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,872,826 (GRCm39) probably benign Homo
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Mn1 GCA GCACCA 5: 111,567,564 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,067,582 (GRCm39) probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,067,583 (GRCm39) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,549,752 (GRCm39) probably benign Het
Nacad GG GGCCAGTG 11: 6,549,760 (GRCm39) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,150,559 (GRCm39) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 35,073,046 (GRCm39) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,716,458 (GRCm39) probably benign Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l GC GCTTC 4: 156,324,557 (GRCm39) probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,119,228 (GRCm39) probably benign Homo
Or2ak5 T G 11: 58,611,197 (GRCm39) I226L probably benign Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Homo
Or51v8 G GAAC 7: 103,320,174 (GRCm39) probably null Homo
Or51v8 CAAA CAAAAAA 7: 103,320,167 (GRCm39) probably benign Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Osmr CTC CTCTTC 15: 6,867,184 (GRCm39) probably benign Homo
Patl2 GCT GCTCCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,006,823 (GRCm39) probably benign Homo
Phldb3 GACCC G 7: 24,328,403 (GRCm39) probably null Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Polr1g GGATG GG 7: 19,091,169 (GRCm39) probably benign Homo
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,571,039 (GRCm39) probably benign Homo
Prr13 TCC TCCGCC 15: 102,370,609 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Homo
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,891,419 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,599,199 (GRCm39) probably benign Het
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,384,485 (GRCm39) probably benign Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,646,819 (GRCm39) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sh3pxd2b T TGTCTTG 11: 32,373,065 (GRCm39) probably benign Het
Sh3pxd2b GT GTGTCTCT 11: 32,373,064 (GRCm39) probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GGC GGCCGC 17: 85,928,791 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 124,996,134 (GRCm39) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,570 (GRCm39) probably benign Het
Spata31h1 G GTCATTA 10: 82,126,830 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,078 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,085 (GRCm39) probably benign Het
Supt20 CA CAGCAGAA 3: 54,635,094 (GRCm39) probably benign Het
Syne1 C A 10: 4,982,969 (GRCm39) S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,105,281 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,295 (GRCm39) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm39) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Het
Triobp TCG TCGCCG 15: 78,877,590 (GRCm39) probably benign Homo
Triobp TCG TCGGCG 15: 78,877,587 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,039 (GRCm39) probably benign Het
Tsen2 GAG GAGAAG 6: 115,537,029 (GRCm39) probably benign Het
Ttf2 TC TCCGC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,223,540 (GRCm39) probably benign Het
Ubtf CTC CTCATC 11: 102,197,784 (GRCm39) probably benign Het
Utrn T TTCCTGTC 10: 12,509,685 (GRCm39) probably benign Homo
Vars1 TGG TGGAGTCCTGGGGGG 17: 35,234,965 (GRCm39) probably benign Homo
Vars1 G GAGTCCTGGGTGC 17: 35,234,967 (GRCm39) probably benign Het
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Het
Vps13b G T 15: 35,847,103 (GRCm39) A2629S probably damaging Homo
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,930,607 (GRCm39) probably null Het
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,749,392 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Zfp986 G T 4: 145,625,928 (GRCm39) R196I probably benign Het
Zfp992 G T 4: 146,550,464 (GRCm39) E62* probably null Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75,567,587 (GRCm39) missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75,573,439 (GRCm39) missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75,547,163 (GRCm39) missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75,581,209 (GRCm39) utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75,567,787 (GRCm39) missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75,569,206 (GRCm39) missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75,531,381 (GRCm39) missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75,531,416 (GRCm39) missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75,553,479 (GRCm39) missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75,561,050 (GRCm39) small insertion probably benign
FR4304:Zc3h13 UTSW 14 75,561,043 (GRCm39) small insertion probably benign
FR4340:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4449:Zc3h13 UTSW 14 75,561,041 (GRCm39) nonsense probably null
FR4589:Zc3h13 UTSW 14 75,561,038 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,037 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,036 (GRCm39) small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75,569,323 (GRCm39) missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75,560,694 (GRCm39) missense unknown
R0374:Zc3h13 UTSW 14 75,546,405 (GRCm39) missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75,560,922 (GRCm39) missense unknown
R0408:Zc3h13 UTSW 14 75,529,626 (GRCm39) nonsense probably null
R0967:Zc3h13 UTSW 14 75,581,179 (GRCm39) missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75,553,424 (GRCm39) missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75,574,923 (GRCm39) nonsense probably null
R2021:Zc3h13 UTSW 14 75,567,635 (GRCm39) missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75,569,587 (GRCm39) missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75,546,380 (GRCm39) nonsense probably null
R3745:Zc3h13 UTSW 14 75,568,101 (GRCm39) missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75,567,178 (GRCm39) missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75,565,041 (GRCm39) missense unknown
R4799:Zc3h13 UTSW 14 75,576,863 (GRCm39) missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75,576,836 (GRCm39) missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75,573,449 (GRCm39) missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75,581,059 (GRCm39) missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75,568,687 (GRCm39) missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75,568,348 (GRCm39) missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75,569,400 (GRCm39) nonsense probably null
R5726:Zc3h13 UTSW 14 75,568,269 (GRCm39) missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75,565,572 (GRCm39) missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75,568,149 (GRCm39) missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75,574,849 (GRCm39) missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75,581,176 (GRCm39) missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75,567,863 (GRCm39) missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75,546,355 (GRCm39) missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75,560,998 (GRCm39) small deletion probably benign
R6598:Zc3h13 UTSW 14 75,569,623 (GRCm39) missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75,568,597 (GRCm39) missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75,559,227 (GRCm39) missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75,559,161 (GRCm39) missense unknown
R7307:Zc3h13 UTSW 14 75,567,981 (GRCm39) missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75,546,349 (GRCm39) missense unknown
R7680:Zc3h13 UTSW 14 75,567,955 (GRCm39) missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75,568,070 (GRCm39) missense not run
R8048:Zc3h13 UTSW 14 75,561,977 (GRCm39) missense unknown
R8059:Zc3h13 UTSW 14 75,565,250 (GRCm39) missense unknown
R8362:Zc3h13 UTSW 14 75,561,909 (GRCm39) missense unknown
R8391:Zc3h13 UTSW 14 75,568,625 (GRCm39) missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75,569,512 (GRCm39) missense probably benign 0.05
R9081:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9082:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9101:Zc3h13 UTSW 14 75,561,042 (GRCm39) missense unknown
R9214:Zc3h13 UTSW 14 75,560,991 (GRCm39) missense unknown
R9308:Zc3h13 UTSW 14 75,565,418 (GRCm39) missense unknown
R9376:Zc3h13 UTSW 14 75,561,128 (GRCm39) missense unknown
R9618:Zc3h13 UTSW 14 75,567,542 (GRCm39) missense
R9665:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
Z1177:Zc3h13 UTSW 14 75,565,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGAGACTCCAGAGACATGCG -3'
(R):5'- GAACTCTCTTCTCTCAGGTGG -3'

Sequencing Primer
(F):5'- TCCAGAGACATGCGGGACTC -3'
(R):5'- CAGGTGGTTTCTGCCATAACTGC -3'
Posted On 2018-04-05