Incidental Mutation 'FR4548:Kng2'
ID 512123
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Name kininogen 2
Synonyms Kininogen-II
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4548 ()
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 22985854-23029482 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 23000552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 245 (Q245*)
Ref Sequence ENSEMBL: ENSMUSP00000111006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000232459]
AlphaFold Q6S9I3
Predicted Effect probably null
Transcript: ENSMUST00000039338
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459
AA Change: Q245*

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100046
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459
AA Change: Q245*

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115349
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459
AA Change: Q245*

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231872
Predicted Effect probably benign
Transcript: ENSMUST00000232459
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,452 (GRCm38) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,668,449 (GRCm38) probably benign Het
2010300C02Rik T A 1: 37,625,035 (GRCm38) E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 (GRCm38) E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 (GRCm38) S47P probably damaging Homo
4930433I11Rik ACCTC AC 7: 40,993,056 (GRCm38) probably benign Het
4932415D10Rik G GTCATTA 10: 82,290,996 (GRCm38) probably benign Homo
Abt1 TTCTTGCT TT 13: 23,423,711 (GRCm38) probably benign Het
Ahdc1 TCC TCCCCC 4: 133,062,757 (GRCm38) probably benign Homo
Ahdc1 T TCCC 4: 133,062,760 (GRCm38) probably benign Homo
AI837181 CG CGGGG 19: 5,425,237 (GRCm38) probably benign Het
AI837181 CGG CGGGGG 19: 5,425,231 (GRCm38) probably benign Het
Anxa2 CCC CCCTCC 9: 69,480,203 (GRCm38) probably benign Het
Anxa7 C T 14: 20,469,411 (GRCm38) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,281,998 (GRCm38) probably benign Het
Apol6 T TGTTA 15: 77,051,445 (GRCm38) probably null Homo
BC051142 GCA GCATCA 17: 34,460,065 (GRCm38) probably benign Het
Blm CTAC CTACTTAC 7: 80,463,769 (GRCm38) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 (GRCm38) probably benign Het
Bud31 C T 5: 145,146,535 (GRCm38) R63C probably benign Het
C4b C T 17: 34,740,997 (GRCm38) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,717 (GRCm38) probably benign Het
Cacna1f AGG AGGGGG X: 7,620,058 (GRCm38) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 (GRCm38) probably benign Het
Cckbr GGGC G 7: 105,434,681 (GRCm38) probably benign Homo
Cd3eap GGATG GG 7: 19,357,244 (GRCm38) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,486,319 (GRCm38) probably benign Homo
Ces1b T C 8: 93,068,092 (GRCm38) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,724,717 (GRCm38) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,572 (GRCm38) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,579 (GRCm38) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 (GRCm38) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,189,594 (GRCm38) probably benign Het
Ctsm GTGA GTGAATGA 13: 61,537,837 (GRCm38) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,463 (GRCm38) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,673 (GRCm38) probably null Het
Dusp10 G T 1: 184,037,056 (GRCm38) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,334,422 (GRCm38) probably benign Homo
Eif3a A ATTTTT 19: 60,775,291 (GRCm38) probably benign Homo
Ermn TC TCTCC 2: 58,048,088 (GRCm38) probably benign Het
Ermn TTC TTCATC 2: 58,048,075 (GRCm38) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,098 (GRCm38) probably null Het
Fscb A G 12: 64,472,563 (GRCm38) S710P unknown Het
Fscb T A 12: 64,472,565 (GRCm38) Q709L unknown Het
Glod4 A C 11: 76,243,310 (GRCm38) probably benign Homo
Gm14401 A G 2: 177,086,868 (GRCm38) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,073 (GRCm38) probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,070 (GRCm38) probably benign Het
Gm8104 C T 14: 43,110,009 (GRCm38) T178I probably benign Het
Gm8104 T C 14: 43,110,011 (GRCm38) S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 78,842,175 (GRCm38) probably benign Het
H2-K1 GTTT G 17: 33,997,042 (GRCm38) probably benign Homo
Hist1h1t GAGAA GA 13: 23,695,920 (GRCm38) probably benign Homo
Hspa1b GCGCC GC 17: 34,957,129 (GRCm38) probably benign Homo
Ifi211 G A 1: 173,906,193 (GRCm38) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 68,226,186 (GRCm38) probably benign Het
Igkv9-129 G A 6: 67,840,034 (GRCm38) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,386,275 (GRCm38) probably benign Het
Kcng4 G T 8: 119,633,519 (GRCm38) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,221,851 (GRCm38) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,586,380 (GRCm38) probably benign Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,281,050 (GRCm38) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,389,276 (GRCm38) probably benign Homo
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,389,273 (GRCm38) probably benign Het
Las1l TC TCTTCCGC X: 95,940,625 (GRCm38) probably benign Het
Las1l GAG GAGAAG X: 95,940,823 (GRCm38) probably benign Het
Lrit3 GCT GCTACT 3: 129,788,816 (GRCm38) probably benign Het
Lrit3 GCT GCTACT 3: 129,788,813 (GRCm38) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,125,182 (GRCm38) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,543,188 (GRCm38) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,736,318 (GRCm38) probably benign Homo
Med12l AGC AGCGGC 3: 59,275,982 (GRCm38) probably benign Het
Mn1 GCA GCACCA 5: 111,419,698 (GRCm38) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,076,109 (GRCm38) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm38) I221F possibly damaging Homo
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,149,346 (GRCm38) probably benign Het
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,149,345 (GRCm38) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,599,752 (GRCm38) probably benign Het
Nacad GG GGCCAGTG 11: 6,599,760 (GRCm38) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,173,596 (GRCm38) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 34,854,070 (GRCm38) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,559,115 (GRCm38) probably benign Het
Nkx2-6 C T 14: 69,175,229 (GRCm38) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 (GRCm38) probably benign Homo
Noc2l GC GCTTC 4: 156,240,100 (GRCm38) probably benign Het
Nphp3 CACG C 9: 104,025,939 (GRCm38) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,397,271 (GRCm38) probably benign Homo
Olfr313 T A 11: 58,817,440 (GRCm38) V144D possibly damaging Homo
Olfr318 T G 11: 58,720,371 (GRCm38) I226L probably benign Het
Olfr585 T TTAG 7: 103,098,309 (GRCm38) probably null Homo
Olfr624 G GAAC 7: 103,670,967 (GRCm38) probably null Homo
Olfr624 CAAA CAAAAAA 7: 103,670,960 (GRCm38) probably benign Homo
Osmr CTC CTCTTC 15: 6,837,703 (GRCm38) probably benign Homo
Patl2 GCT GCTCCT 2: 122,126,135 (GRCm38) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,279,512 (GRCm38) probably benign Homo
Phldb3 GACCC G 7: 24,628,978 (GRCm38) probably null Het
Piezo1 G A 8: 122,495,569 (GRCm38) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 (GRCm38) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 (GRCm38) probably benign Homo
Ppp1r3f C A X: 7,560,336 (GRCm38) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,103,885 (GRCm38) probably benign Homo
Prr13 TCC TCCGCC 15: 102,462,174 (GRCm38) probably benign Het
Prtg GTAAC G 9: 72,857,081 (GRCm38) probably benign Homo
Ptk2b C T 14: 66,173,849 (GRCm38) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,914,456 (GRCm38) probably benign Het
Ptpn23 G T 9: 110,387,633 (GRCm38) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,394,201 (GRCm38) probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 (GRCm38) probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,785,313 (GRCm38) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,569,749 (GRCm38) probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,569,755 (GRCm38) probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,423,065 (GRCm38) probably benign Het
Sh3pxd2b GT GTGTCTCT 11: 32,423,064 (GRCm38) probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 (GRCm38) probably benign Het
Six3 GGC GGCCGC 17: 85,621,363 (GRCm38) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 125,154,214 (GRCm38) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm38) probably benign Het
Spag17 AGG AGGCGG 3: 100,056,254 (GRCm38) probably benign Het
Srebf2 G T 15: 82,185,335 (GRCm38) A693S probably damaging Homo
Supt20 CA CAGCAGAA 3: 54,727,673 (GRCm38) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,664 (GRCm38) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,657 (GRCm38) probably benign Het
Syne1 C A 10: 5,032,969 (GRCm38) S8652I probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,469 (GRCm38) probably benign Het
Tob1 GCA GCAACA 11: 94,214,455 (GRCm38) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm38) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,649,757 (GRCm38) probably benign Het
Triobp TCG TCGCCG 15: 78,993,390 (GRCm38) probably benign Homo
Triobp TCG TCGGCG 15: 78,993,387 (GRCm38) probably benign Het
Tsen2 GAG GAGAAG 6: 115,560,068 (GRCm38) probably benign Het
Ttf2 TC TCCGC 3: 100,963,160 (GRCm38) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,335,303 (GRCm38) probably benign Het
Ubtf CTC CTCATC 11: 102,306,958 (GRCm38) probably benign Het
Utrn T TTCCTGTC 10: 12,633,941 (GRCm38) probably benign Homo
Vars TGG TGGAGTCCTGGGGGG 17: 35,015,989 (GRCm38) probably benign Homo
Vars G GAGTCCTGGGTGC 17: 35,015,991 (GRCm38) probably benign Het
Vmn2r99 G A 17: 19,394,285 (GRCm38) G756R probably damaging Het
Vps13b G T 15: 35,846,957 (GRCm38) A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,323,599 (GRCm38) probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,942,168 (GRCm38) probably null Het
Zfp26 C A 9: 20,438,546 (GRCm38) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,907,472 (GRCm38) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 (GRCm38) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 (GRCm38) probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 (GRCm38) probably null Het
Zfp986 G T 4: 145,899,358 (GRCm38) R196I probably benign Het
Zfp992 G T 4: 146,466,007 (GRCm38) E62* probably null Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23,028,830 (GRCm38) missense probably damaging 1.00
IGL01319:Kng2 APN 16 23,028,834 (GRCm38) missense probably damaging 0.99
IGL01469:Kng2 APN 16 22,999,827 (GRCm38) missense probably damaging 1.00
IGL01681:Kng2 APN 16 22,997,017 (GRCm38) splice site probably benign
IGL01830:Kng2 APN 16 22,988,051 (GRCm38) missense probably damaging 0.97
IGL01903:Kng2 APN 16 22,987,790 (GRCm38) missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22,987,832 (GRCm38) missense probably damaging 0.97
IGL02305:Kng2 APN 16 23,000,624 (GRCm38) unclassified probably benign
IGL02429:Kng2 APN 16 23,012,079 (GRCm38) missense probably damaging 0.99
R0020:Kng2 UTSW 16 22,997,296 (GRCm38) missense probably benign 0.02
R0047:Kng2 UTSW 16 22,987,563 (GRCm38) missense possibly damaging 0.83
R0245:Kng2 UTSW 16 23,012,181 (GRCm38) splice site probably benign
R0610:Kng2 UTSW 16 23,000,594 (GRCm38) missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22,987,736 (GRCm38) missense probably benign 0.10
R0666:Kng2 UTSW 16 22,997,122 (GRCm38) splice site probably benign
R1552:Kng2 UTSW 16 22,987,520 (GRCm38) missense probably damaging 1.00
R1765:Kng2 UTSW 16 22,988,243 (GRCm38) critical splice donor site probably null
R1833:Kng2 UTSW 16 23,012,052 (GRCm38) missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23,024,876 (GRCm38) missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23,000,575 (GRCm38) missense probably benign 0.15
R2056:Kng2 UTSW 16 22,987,953 (GRCm38) intron probably benign
R2137:Kng2 UTSW 16 22,997,326 (GRCm38) intron probably benign
R2517:Kng2 UTSW 16 22,988,315 (GRCm38) missense probably benign 0.24
R3438:Kng2 UTSW 16 23,012,071 (GRCm38) missense probably benign 0.23
R3439:Kng2 UTSW 16 23,012,071 (GRCm38) missense probably benign 0.23
R3551:Kng2 UTSW 16 23,011,995 (GRCm38) critical splice donor site probably null
R4389:Kng2 UTSW 16 23,024,868 (GRCm38) missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22,988,063 (GRCm38) missense probably benign 0.00
R4684:Kng2 UTSW 16 22,987,641 (GRCm38) missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22,987,916 (GRCm38) missense probably damaging 1.00
R5658:Kng2 UTSW 16 22,997,020 (GRCm38) splice site probably null
R6074:Kng2 UTSW 16 23,000,596 (GRCm38) missense probably benign 0.03
R6216:Kng2 UTSW 16 22,987,593 (GRCm38) missense probably damaging 1.00
R6271:Kng2 UTSW 16 23,003,948 (GRCm38) missense probably benign 0.33
R6459:Kng2 UTSW 16 23,012,115 (GRCm38) missense probably damaging 1.00
R7124:Kng2 UTSW 16 23,012,055 (GRCm38) missense probably damaging 1.00
R7310:Kng2 UTSW 16 22,987,772 (GRCm38) missense probably benign 0.00
R7532:Kng2 UTSW 16 23,027,044 (GRCm38) splice site probably null
R7667:Kng2 UTSW 16 22,988,232 (GRCm38) missense probably damaging 0.99
R7787:Kng2 UTSW 16 22,999,848 (GRCm38) missense probably damaging 1.00
R8092:Kng2 UTSW 16 22,987,922 (GRCm38) missense probably benign 0.00
R8165:Kng2 UTSW 16 22,987,496 (GRCm38) missense unknown
R8814:Kng2 UTSW 16 23,004,011 (GRCm38) missense probably benign 0.00
R9019:Kng2 UTSW 16 23,028,796 (GRCm38) missense probably damaging 0.99
R9048:Kng2 UTSW 16 22,987,772 (GRCm38) missense probably benign 0.00
R9531:Kng2 UTSW 16 23,012,157 (GRCm38) missense possibly damaging 0.81
R9708:Kng2 UTSW 16 22,997,051 (GRCm38) missense probably damaging 0.99
R9764:Kng2 UTSW 16 23,003,987 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGTTTGCCCATGTTCAC -3'
(R):5'- AGCATGGCTATCTGTGTTTCTC -3'

Sequencing Primer
(F):5'- GGCATTATATGTCCCAAGCCAG -3'
(R):5'- ATGGCTATCTGTGTTTCTCATTTTC -3'
Posted On 2018-04-05