Incidental Mutation 'FR4548:Apc'
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #FR4548 ()
Quality Score217.468
Status Not validated
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) CCAATAAAG to CCAATAAAGACAATAAAG at 34281998 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066133] [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably benign
Transcript: ENSMUST00000066133
SMART Domains Protein: ENSMUSP00000064214
Gene: ENSMUSG00000005871

PDB:1DEB|B 2 55 8e-29 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 2.3e-32 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079362
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871

Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115781
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871

PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170023
Predicted Effect probably benign
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,668,452 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4932415D10Rik G GTCATTA 10: 82,290,996 probably benign Homo
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
Ahdc1 TCC TCCCCC 4: 133,062,757 probably benign Homo
Ahdc1 T TCCC 4: 133,062,760 probably benign Homo
AI837181 CGG CGGGGG 19: 5,425,231 probably benign Het
AI837181 CG CGGGG 19: 5,425,237 probably benign Het
Anxa2 CCC CCCTCC 9: 69,480,203 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apol6 T TGTTA 15: 77,051,445 probably null Homo
BC051142 GCA GCATCA 17: 34,460,065 probably benign Het
Blm CTAC CTACTTAC 7: 80,463,769 probably null Homo
Bud31 C T 5: 145,146,535 R63C probably benign Het
C4b C T 17: 34,740,997 R335H probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,717 probably benign Het
Cacna1f AGG AGGGGG X: 7,620,058 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cckbr GGGC G 7: 105,434,681 probably benign Homo
Cd3eap GGATG GG 7: 19,357,244 probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,486,319 probably benign Homo
Ces1b T C 8: 93,068,092 N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,724,717 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,579 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,189,594 probably benign Het
Ctsm GTGA GTGAATGA 13: 61,537,837 probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,463 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,673 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,334,422 probably benign Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn TTC TTCATC 2: 58,048,075 probably benign Het
Ermn TC TCTCC 2: 58,048,088 probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,098 probably null Het
Fscb A G 12: 64,472,563 S710P unknown Het
Fscb T A 12: 64,472,565 Q709L unknown Het
Glod4 A C 11: 76,243,310 probably benign Homo
Gm14401 A G 2: 177,086,868 D249G probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,070 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,073 probably benign Het
Gm8104 C T 14: 43,110,009 T178I probably benign Het
Gm8104 T C 14: 43,110,011 S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 78,842,175 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Ifi211 G A 1: 173,906,193 A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 68,226,186 probably benign Het
Igkv9-129 G A 6: 67,840,034 V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,386,275 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,221,851 probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,586,380 probably benign Het
Kng2 G A 16: 23,000,552 Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,281,050 probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,389,273 probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,389,276 probably benign Homo
Las1l TC TCTTCCGC X: 95,940,625 probably benign Het
Las1l GAG GAGAAG X: 95,940,823 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,813 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,816 probably benign Het
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,543,188 probably benign Homo
Mast4 CA CAGTGGGA 13: 102,736,318 probably benign Homo
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Mn1 GCA GCACCA 5: 111,419,698 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,076,109 probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,149,345 probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,149,346 probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,599,752 probably benign Het
Nacad GG GGCCAGTG 11: 6,599,760 probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,173,596 probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,559,115 probably benign Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l GC GCTTC 4: 156,240,100 probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 TTG TTGACACTG 14: 38,397,271 probably benign Homo
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr318 T G 11: 58,720,371 I226L probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Homo
Olfr624 CAAA CAAAAAA 7: 103,670,960 probably benign Homo
Olfr624 G GAAC 7: 103,670,967 probably null Homo
Osmr CTC CTCTTC 15: 6,837,703 probably benign Homo
Patl2 GCT GCTCCT 2: 122,126,135 probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,279,512 probably benign Homo
Phldb3 GACCC G 7: 24,628,978 probably null Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,103,885 probably benign Homo
Prr13 TCC TCCGCC 15: 102,462,174 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Homo
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,914,456 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,394,201 probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,785,313 probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,569,749 probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,569,755 probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,423,064 probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,423,065 probably benign Het
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GGC GGCCGC 17: 85,621,363 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 125,154,214 probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,254 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,664 probably benign Het
Supt20 CA CAGCAGAA 3: 54,727,673 probably benign Het
Syne1 C A 10: 5,032,969 S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,214,455 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,469 probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Het
Triobp TCG TCGGCG 15: 78,993,387 probably benign Het
Triobp TCG TCGCCG 15: 78,993,390 probably benign Homo
Tsen2 GAG GAGAAG 6: 115,560,068 probably benign Het
Ttf2 TC TCCGC 3: 100,963,160 probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,335,303 probably benign Het
Ubtf CTC CTCATC 11: 102,306,958 probably benign Het
Utrn T TTCCTGTC 10: 12,633,941 probably benign Homo
Vars TGG TGGAGTCCTGGGGGG 17: 35,015,989 probably benign Homo
Vars G GAGTCCTGGGTGC 17: 35,015,991 probably benign Het
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,323,599 probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,942,168 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,907,472 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Zfp986 G T 4: 145,899,358 R196I probably benign Het
Zfp992 G T 4: 146,466,007 E62* probably null Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7027:Apc UTSW 18 34312076 missense probably damaging 1.00
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
R7534:Apc UTSW 18 34316962 missense probably damaging 1.00
R7685:Apc UTSW 18 34314208 missense probably damaging 1.00
R7814:Apc UTSW 18 34272539 missense probably damaging 0.98
RF046:Apc UTSW 18 34282009 critical splice donor site probably benign
RF063:Apc UTSW 18 34282009 critical splice donor site probably benign
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Z1177:Apc UTSW 18 34314463 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05