Incidental Mutation 'R6256:Mogat2'
ID512155
Institutional Source Beutler Lab
Gene Symbol Mogat2
Ensembl Gene ENSMUSG00000052396
Gene Namemonoacylglycerol O-acyltransferase 2
SynonymsDGAT2L5, Mgat2
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99219084-99238619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99219895 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 305 (H305Q)
Ref Sequence ENSEMBL: ENSMUSP00000064041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064231]
Predicted Effect probably damaging
Transcript: ENSMUST00000064231
AA Change: H305Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064041
Gene: ENSMUSG00000052396
AA Change: H305Q

DomainStartEndE-ValueType
Pfam:DAGAT 39 334 9.1e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208323
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA. The encoded protein is important in the uptake of dietary fat by the small intestine. This protein forms a complex with diacylglycerol O-acyltransferase 2 in the endoplasmic reticulum, and this complex catalyzes the synthesis of triacylglycerol. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit resistance to diet induced obesity, hyperinsulinemia, hyperlipidemia, and steatosis with decreased lipid absorption and increased oxygen consumption when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Mogat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mogat2 APN 7 99232568 missense possibly damaging 0.60
IGL02052:Mogat2 APN 7 99238564 start codon destroyed probably null 0.99
IGL02153:Mogat2 APN 7 99223554 missense possibly damaging 0.94
R0227:Mogat2 UTSW 7 99223132 missense probably benign 0.02
R0490:Mogat2 UTSW 7 99223144 missense probably benign 0.11
R1331:Mogat2 UTSW 7 99223515 missense possibly damaging 0.66
R1546:Mogat2 UTSW 7 99232559 missense probably damaging 1.00
R2879:Mogat2 UTSW 7 99222366 missense possibly damaging 0.46
R4954:Mogat2 UTSW 7 99238517 missense possibly damaging 0.95
R5040:Mogat2 UTSW 7 99238517 missense possibly damaging 0.95
R5184:Mogat2 UTSW 7 99223635 missense possibly damaging 0.90
R5822:Mogat2 UTSW 7 99219905 missense possibly damaging 0.82
R6056:Mogat2 UTSW 7 99223513 missense possibly damaging 0.95
R6500:Mogat2 UTSW 7 99222346 missense probably benign 0.04
R7358:Mogat2 UTSW 7 99232466 missense possibly damaging 0.93
R7375:Mogat2 UTSW 7 99223698 missense probably damaging 1.00
Y5408:Mogat2 UTSW 7 99223630 missense probably damaging 1.00
Z1177:Mogat2 UTSW 7 99223629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAGGATTAGGAGCTGC -3'
(R):5'- CTTATACACAAACATGGGGTGAGG -3'

Sequencing Primer
(F):5'- ATTAGGAGCTGCCCCCTC -3'
(R):5'- TACACAAACATGGGGTGAGGGAAAG -3'
Posted On2018-04-05