Incidental Mutation 'R6256:Mogat2'
ID 512155
Institutional Source Beutler Lab
Gene Symbol Mogat2
Ensembl Gene ENSMUSG00000052396
Gene Name monoacylglycerol O-acyltransferase 2
Synonyms DGAT2L5, Mgat2
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 98868291-98887818 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98869102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 305 (H305Q)
Ref Sequence ENSEMBL: ENSMUSP00000064041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064231]
AlphaFold Q80W94
Predicted Effect probably damaging
Transcript: ENSMUST00000064231
AA Change: H305Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064041
Gene: ENSMUSG00000052396
AA Change: H305Q

DomainStartEndE-ValueType
Pfam:DAGAT 39 334 9.1e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208323
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA. The encoded protein is important in the uptake of dietary fat by the small intestine. This protein forms a complex with diacylglycerol O-acyltransferase 2 in the endoplasmic reticulum, and this complex catalyzes the synthesis of triacylglycerol. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit resistance to diet induced obesity, hyperinsulinemia, hyperlipidemia, and steatosis with decreased lipid absorption and increased oxygen consumption when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ccdc7a T C 8: 129,662,074 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnase1 G A 16: 3,855,485 (GRCm39) R24K probably benign Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mepe A T 5: 104,484,940 (GRCm39) M27L probably benign Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Ppm1l A G 3: 69,405,230 (GRCm39) I176V probably benign Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tmem232 G T 17: 65,785,397 (GRCm39) Q188K possibly damaging Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Mogat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mogat2 APN 7 98,881,775 (GRCm39) missense possibly damaging 0.60
IGL02052:Mogat2 APN 7 98,887,771 (GRCm39) start codon destroyed probably null 0.99
IGL02153:Mogat2 APN 7 98,872,761 (GRCm39) missense possibly damaging 0.94
R0227:Mogat2 UTSW 7 98,872,339 (GRCm39) missense probably benign 0.02
R0490:Mogat2 UTSW 7 98,872,351 (GRCm39) missense probably benign 0.11
R1331:Mogat2 UTSW 7 98,872,722 (GRCm39) missense possibly damaging 0.66
R1546:Mogat2 UTSW 7 98,881,766 (GRCm39) missense probably damaging 1.00
R2879:Mogat2 UTSW 7 98,871,573 (GRCm39) missense possibly damaging 0.46
R4954:Mogat2 UTSW 7 98,887,724 (GRCm39) missense possibly damaging 0.95
R5040:Mogat2 UTSW 7 98,887,724 (GRCm39) missense possibly damaging 0.95
R5184:Mogat2 UTSW 7 98,872,842 (GRCm39) missense possibly damaging 0.90
R5822:Mogat2 UTSW 7 98,869,112 (GRCm39) missense possibly damaging 0.82
R6056:Mogat2 UTSW 7 98,872,720 (GRCm39) missense possibly damaging 0.95
R6500:Mogat2 UTSW 7 98,871,553 (GRCm39) missense probably benign 0.04
R7358:Mogat2 UTSW 7 98,881,673 (GRCm39) missense possibly damaging 0.93
R7375:Mogat2 UTSW 7 98,872,905 (GRCm39) missense probably damaging 1.00
Y5408:Mogat2 UTSW 7 98,872,837 (GRCm39) missense probably damaging 1.00
Z1177:Mogat2 UTSW 7 98,872,836 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAGGATTAGGAGCTGC -3'
(R):5'- CTTATACACAAACATGGGGTGAGG -3'

Sequencing Primer
(F):5'- ATTAGGAGCTGCCCCCTC -3'
(R):5'- TACACAAACATGGGGTGAGGGAAAG -3'
Posted On 2018-04-05