Incidental Mutation 'R6067:Theg'
ID512227
Institutional Source Beutler Lab
Gene Symbol Theg
Ensembl Gene ENSMUSG00000020317
Gene Nametesticular haploid expressed gene
Synonyms
MMRRC Submission 044231-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6067 (G1)
Quality Score200.009
Status Validated
Chromosome10
Chromosomal Location79576379-79587331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79584755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000076647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020566] [ENSMUST00000077433]
Predicted Effect probably damaging
Transcript: ENSMUST00000020566
AA Change: S183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020566
Gene: ENSMUSG00000020317
AA Change: S183P

DomainStartEndE-ValueType
THEG 9 28 1.68e2 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 2.22e-2 SMART
THEG 176 195 4.69e-1 SMART
THEG 214 233 9.16e-4 SMART
THEG 250 269 7.22e-2 SMART
THEG 282 301 2.31e0 SMART
THEG 318 337 4.45e-2 SMART
THEG 352 371 1.96e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077433
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076647
Gene: ENSMUSG00000020317
AA Change: S159P

DomainStartEndE-ValueType
THEG 9 28 6.2e-1 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 7.8e-5 SMART
THEG 152 171 1.7e-3 SMART
THEG 190 209 3.3e-6 SMART
THEG 226 245 2.5e-4 SMART
THEG 258 277 8.3e-3 SMART
THEG 294 313 1.6e-4 SMART
THEG 328 347 7e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159782
Meta Mutation Damage Score 0.1892 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the nucleus of haploid male germ cells. The orthologous gene in mice encodes a protein that may play a role in protein assembly through interactions with T-complex protein 1 subunit epsilon. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygotes for a transgenic insertional mutation are sterile due to a block in spermiogenesis. Testis weights are reduced, and mutants exhibit multiple abnormalities in elongated spermatids in the seminiferous tubule lumen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 C T 8: 40,824,593 A7V probably benign Het
Cbfa2t3 T C 8: 122,643,497 H53R probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Kitl G A 10: 100,076,906 probably null Het
Muc4 T A 16: 32,755,247 probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nop14 T C 5: 34,657,951 D85G probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Zfp1 T C 8: 111,670,343 F299S probably damaging Het
Other mutations in Theg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Theg APN 10 79576599 missense probably damaging 0.99
IGL02013:Theg APN 10 79579935 splice site probably null
R0087:Theg UTSW 10 79585951 nonsense probably null
R1035:Theg UTSW 10 79583850 missense probably damaging 1.00
R4133:Theg UTSW 10 79580050 missense probably damaging 0.97
R5960:Theg UTSW 10 79585931 missense possibly damaging 0.76
R5971:Theg UTSW 10 79584755 missense probably damaging 1.00
R6138:Theg UTSW 10 79584755 missense probably damaging 1.00
R6357:Theg UTSW 10 79586955 missense probably benign 0.28
R7046:Theg UTSW 10 79586962 missense probably benign 0.35
R7117:Theg UTSW 10 79584907 splice site probably null
R7463:Theg UTSW 10 79576715 missense probably damaging 0.99
R8441:Theg UTSW 10 79576676 missense probably damaging 1.00
R8739:Theg UTSW 10 79583747 missense possibly damaging 0.80
R8883:Theg UTSW 10 79576640 missense probably benign 0.10
R9060:Theg UTSW 10 79584737 missense probably damaging 1.00
U15987:Theg UTSW 10 79584755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGACTGCTAAGGGAC -3'
(R):5'- CTCTTAGGTTTAACCATGGGGAGG -3'

Sequencing Primer
(F):5'- GACATTGGCTAGACCTCTTGAGAC -3'
(R):5'- GGAAGGAGCCAGTCTTGTC -3'
Posted On2018-04-12