Mutagenetix > Incidental Mutation

Incidental Mutation 'R6067:Pgk1'

512242

Institutional Source

Beutler Lab

Gene Symbol

Pgk1

Ensembl Gene

ENSMUSG00000062070

Gene Name

phosphoglycerate kinase 1

Synonyms

Pgk-1

MMRRC Submission

044231-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R6067 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105230706-105247305 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105238098 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 85 (L85I)

Ref Sequence

ENSEMBL: ENSMUSP00000080302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081593] [ENSMUST00000135949]

AlphaFold

P09411

PDB Structure

Crystal Structure of mouse PGK1 3PG and terazosin(TZN) ternary complex [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081593
AA Change: L85I

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080302
Gene: ENSMUSG00000062070
AA Change: L85I

Domain	Start	End	E-Value	Type
Pfam:PGK	9	406	1e-152	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133559

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135949
AA Change: L85I

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138706
Gene: ENSMUSG00000062070
AA Change: L85I

Domain	Start	End	E-Value	Type
Pfam:PGK	8	253	3.9e-94	PFAM

Meta Mutation Damage Score

0.4493

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. Additionally, this protein is secreted by tumor cells where it participates in angiogenesis by functioning to reduce disulfide bonds in the serine protease, plasmin, which consequently leads to the release of the tumor blood vessel inhibitor angiostatin. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Many pseudogenes of this gene are found throughout the mouse genome. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	C	T	8: 41,277,630 (GRCm39)	A7V	probably benign	Het
Cbfa2t3	T	C	8: 123,370,236 (GRCm39)	H53R	probably benign	Het
Fam90a1b	T	C	X: 93,400,191 (GRCm39)	N213S	probably benign	Het
Insm2	T	C	12: 55,646,799 (GRCm39)	I181T	probably damaging	Het
Kitl	G	A	10: 99,912,768 (GRCm39)		probably null	Het
Muc4	T	A	16: 32,575,621 (GRCm39)		probably benign	Het
Muc4	C	A	16: 32,754,529 (GRCm38)	H1468N	probably benign	Het
Nop14	T	C	5: 34,815,295 (GRCm39)	D85G	probably damaging	Het
Rad23b	C	T	4: 55,370,400 (GRCm39)	A142V	probably damaging	Het
Satl1	T	C	X: 111,315,613 (GRCm39)	T281A	probably benign	Het
Spmap2	A	G	10: 79,420,589 (GRCm39)	S159P	probably damaging	Het
Tbx5	T	C	5: 120,021,211 (GRCm39)	S406P	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Zfp1	T	C	8: 112,396,975 (GRCm39)	F299S	probably damaging	Het

Other mutations in Pgk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1768:Pgk1	UTSW	X	105,243,914 (GRCm39)	missense	possibly damaging	0.73
R6079:Pgk1	UTSW	X	105,238,098 (GRCm39)	missense	possibly damaging	0.79
R6138:Pgk1	UTSW	X	105,238,098 (GRCm39)	missense	possibly damaging	0.79
U15987:Pgk1	UTSW	X	105,238,098 (GRCm39)	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AGTCATGAGTTCAAATAGTTCCCAC -3'
(R):5'- GCACAGGCATTCTCGACTTC -3'

Sequencing Primer
(F):5'- AAATAGTTCCCACTAATTCCTCGG -3'
(R):5'- AGGCATTCTCGACTTCTGGGC -3'

Posted On

2018-04-12