Incidental Mutation 'R5902:Irf2bp1'
ID 512250
Institutional Source Beutler Lab
Gene Symbol Irf2bp1
Ensembl Gene ENSMUSG00000044030
Gene Name interferon regulatory factor 2 binding protein 1
Synonyms
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock # R5902 (G1)
Quality Score 54
Status Validated
Chromosome 7
Chromosomal Location 19004044-19006777 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19004447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000061234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053713] [ENSMUST00000059331] [ENSMUST00000131087]
AlphaFold Q8R3Y8
Predicted Effect probably benign
Transcript: ENSMUST00000053713
AA Change: V4A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000061234
Gene: ENSMUSG00000044030
AA Change: V4A

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 8 59 9.5e-37 PFAM
low complexity region 82 105 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
low complexity region 441 458 N/A INTRINSIC
low complexity region 481 500 N/A INTRINSIC
Pfam:zf-C3HC4 503 549 1.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059331
SMART Domains Protein: ENSMUSP00000058718
Gene: ENSMUSG00000048481

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
SANT 20 90 4.06e-5 SMART
low complexity region 125 157 N/A INTRINSIC
low complexity region 212 250 N/A INTRINSIC
low complexity region 278 322 N/A INTRINSIC
low complexity region 323 347 N/A INTRINSIC
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124897
Predicted Effect probably benign
Transcript: ENSMUST00000131087
SMART Domains Protein: ENSMUSP00000117357
Gene: ENSMUSG00000048481

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
SANT 20 90 4.06e-5 SMART
low complexity region 125 157 N/A INTRINSIC
low complexity region 212 250 N/A INTRINSIC
low complexity region 278 322 N/A INTRINSIC
low complexity region 323 347 N/A INTRINSIC
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206381
Meta Mutation Damage Score 0.0829 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Irf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Irf2bp1 APN 7 19006027 missense possibly damaging 0.86
IGL01983:Irf2bp1 APN 7 19005295 missense possibly damaging 0.70
R0063:Irf2bp1 UTSW 7 19005847 missense possibly damaging 0.91
R0255:Irf2bp1 UTSW 7 19005002 missense possibly damaging 0.91
R0849:Irf2bp1 UTSW 7 19004734 missense possibly damaging 0.73
R2250:Irf2bp1 UTSW 7 19005799 missense probably benign 0.12
R3972:Irf2bp1 UTSW 7 19005444 missense possibly damaging 0.70
R4703:Irf2bp1 UTSW 7 19005571 missense possibly damaging 0.91
R5290:Irf2bp1 UTSW 7 19004998 missense possibly damaging 0.85
R5729:Irf2bp1 UTSW 7 19005247 nonsense probably null
R6874:Irf2bp1 UTSW 7 19005217 missense possibly damaging 0.70
R8260:Irf2bp1 UTSW 7 19006154 missense possibly damaging 0.85
R9291:Irf2bp1 UTSW 7 19004533 missense probably damaging 1.00
R9295:Irf2bp1 UTSW 7 19005815 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGCGCGTTATGTAACTTTC -3'
(R):5'- AGGCTAGGTCCTTGGAAGTC -3'

Sequencing Primer
(F):5'- GTTATGTAACTTTCCCTGCGAAGCG -3'
(R):5'- CCTTGGAAGTCGGGTGC -3'
Posted On 2018-04-12