Incidental Mutation 'R6073:Ihh'
ID512255
Institutional Source Beutler Lab
Gene Symbol Ihh
Ensembl Gene ENSMUSG00000006538
Gene NameIndian hedgehog
Synonyms
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6073 (G1)
Quality Score56.0072
Status Validated
Chromosome1
Chromosomal Location74945315-74951672 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 74951279 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164097]
Predicted Effect probably benign
Transcript: ENSMUST00000164097
SMART Domains Protein: ENSMUSP00000128056
Gene: ENSMUSG00000006538

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Pfam:HH_signal 66 227 2.7e-88 PFAM
HintN 239 346 3.15e-29 SMART
HintC 347 391 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194616
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes die before or immediately after birth due to respiratory failure, exhibiting limb dwarfism associated with reduced chondrocyte proliferation, ectopic maturation of chondrocytes, and a failure of osteoblast development in endochondral bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Ihh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ihh APN 1 74946442 missense probably damaging 1.00
IGL02174:Ihh APN 1 74950946 missense probably damaging 0.98
Echidna UTSW 1 74946727 missense probably benign 0.08
R0047:Ihh UTSW 1 74946591 missense probably benign 0.01
R0047:Ihh UTSW 1 74946591 missense probably benign 0.01
R1404:Ihh UTSW 1 74951213 start codon destroyed probably null
R1404:Ihh UTSW 1 74951213 start codon destroyed probably null
R2936:Ihh UTSW 1 74946546 missense probably damaging 0.97
R4520:Ihh UTSW 1 74950950 missense probably damaging 1.00
R4540:Ihh UTSW 1 74948399 missense possibly damaging 0.94
R5399:Ihh UTSW 1 74946277 missense probably benign 0.00
R5736:Ihh UTSW 1 74946127 missense probably benign
R6026:Ihh UTSW 1 74946727 missense probably benign 0.08
R6458:Ihh UTSW 1 74946442 missense probably damaging 1.00
R6489:Ihh UTSW 1 74946511 missense probably damaging 1.00
R7311:Ihh UTSW 1 74951147 missense unknown
R7350:Ihh UTSW 1 74948333 missense probably damaging 1.00
R7818:Ihh UTSW 1 74946645 missense possibly damaging 0.84
R7835:Ihh UTSW 1 74946366 missense probably damaging 0.98
Z1176:Ihh UTSW 1 74946094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAAGCGCTCAGAGCTGC -3'
(R):5'- AACGGGCCGGCCTATTTATTG -3'

Posted On2018-04-12