Incidental Mutation 'R6073:Tmem59'
ID512257
Institutional Source Beutler Lab
Gene Symbol Tmem59
Ensembl Gene ENSMUSG00000028618
Gene Nametransmembrane protein 59
Synonyms3110046P06Rik, thymic dendritic cell-derived factor 1, D4Ertd20e, 1110001M20Rik, MTDCF1
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location107178399-107200996 bp(+) (GRCm38)
Type of Mutationsplice site (2714 bp from exon)
DNA Base Change (assembly) T to A at 107193401 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030361] [ENSMUST00000106753] [ENSMUST00000128123] [ENSMUST00000154007]
Predicted Effect probably null
Transcript: ENSMUST00000030361
SMART Domains Protein: ENSMUSP00000030361
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:BSMAP 72 256 1.1e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106753
SMART Domains Protein: ENSMUSP00000102364
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 32 189 2.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127652
Predicted Effect probably null
Transcript: ENSMUST00000128123
SMART Domains Protein: ENSMUSP00000120288
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 18 127 1.7e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141013
Predicted Effect probably benign
Transcript: ENSMUST00000154007
SMART Domains Protein: ENSMUSP00000119701
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein shown to regulate autophagy in response to bacterial infection. This protein may also regulate the retention of amyloid precursor protein (APP) in the Golgi apparatus through its control of APP glycosylation. Overexpression of this protein has been found to promote apoptosis in a glioma cell line. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele display reduced dendritic arborization, reduced miniature excitatory postsynaptic currents, and impaired memory formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Tmem59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02663:Tmem59 APN 4 107197541 missense probably damaging 1.00
IGL02695:Tmem59 APN 4 107193314 missense probably benign 0.00
IGL02699:Tmem59 APN 4 107192538 missense probably benign 0.01
IGL02937:Tmem59 APN 4 107197585 missense probably damaging 1.00
R0945:Tmem59 UTSW 4 107187725 splice site probably benign
R2080:Tmem59 UTSW 4 107178774 missense probably damaging 0.99
R4621:Tmem59 UTSW 4 107190718 intron probably benign
R4622:Tmem59 UTSW 4 107190718 intron probably benign
R4623:Tmem59 UTSW 4 107190718 intron probably benign
R4819:Tmem59 UTSW 4 107187681 nonsense probably null
R5413:Tmem59 UTSW 4 107200462 missense probably benign 0.00
R5866:Tmem59 UTSW 4 107190557 missense probably damaging 0.99
RF031:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF033:Tmem59 UTSW 4 107190528 critical splice acceptor site probably benign
RF035:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF040:Tmem59 UTSW 4 107190526 critical splice acceptor site probably benign
RF041:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF044:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF060:Tmem59 UTSW 4 107190526 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCTTACACTTAGAAAGCTCCTTAGAG -3'
(R):5'- AAACATGCCATATCCCACATATTTG -3'

Posted On2018-04-12