Incidental Mutation 'R6353:Intu'
ID 512282
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 044505-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40608138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 32 (D32V)
Ref Sequence ENSEMBL: ENSMUSP00000054313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: D32V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: D32V

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000091186
AA Change: D50V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D50V

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik C A 9: 53,325,642 (GRCm39) Q60K probably benign Het
Aadacl2fm2 A T 3: 59,659,529 (GRCm39) L327F probably damaging Het
Aamp T C 1: 74,319,987 (GRCm39) D397G probably benign Het
Aco1 G A 4: 40,186,367 (GRCm39) R593Q probably benign Het
Acta1 T C 8: 124,620,426 (GRCm39) E4G probably benign Het
Apob A T 12: 8,059,421 (GRCm39) K2601N probably damaging Het
Arpin C A 7: 79,585,093 (GRCm39) probably benign Het
Asnsd1 T C 1: 53,386,938 (GRCm39) I230V probably benign Het
Baiap2l1 C T 5: 144,218,898 (GRCm39) E237K possibly damaging Het
Chek1 T C 9: 36,635,255 (GRCm39) K43E probably benign Het
Clec2g T A 6: 128,959,895 (GRCm39) probably null Het
Cnot10 A G 9: 114,426,614 (GRCm39) L646P probably damaging Het
Cyp2j9 T C 4: 96,474,135 (GRCm39) T102A probably benign Het
Dnase1l2 A T 17: 24,661,219 (GRCm39) L30Q probably damaging Het
Edc3 T C 9: 57,623,520 (GRCm39) S152P probably benign Het
Gask1b A T 3: 79,848,647 (GRCm39) R464S probably damaging Het
Gpr160 A T 3: 30,950,171 (GRCm39) D81V probably damaging Het
Itga5 T C 15: 103,260,950 (GRCm39) E512G probably damaging Het
Khnyn T C 14: 56,131,760 (GRCm39) F561L possibly damaging Het
Kmt2e T A 5: 23,698,243 (GRCm39) V645E probably damaging Het
Mcoln3 T C 3: 145,836,909 (GRCm39) F247S probably damaging Het
Nek9 G A 12: 85,348,603 (GRCm39) T977I probably damaging Het
Nphs1 A G 7: 30,173,969 (GRCm39) T1015A probably damaging Het
Ntmt2 A G 1: 163,531,680 (GRCm39) Y158H possibly damaging Het
Nudcd1 T C 15: 44,284,158 (GRCm39) Y76C probably damaging Het
Or2a54 C A 6: 43,093,070 (GRCm39) Y131* probably null Het
Or8b44 T C 9: 38,410,112 (GRCm39) I49T probably benign Het
Pgd C T 4: 149,245,209 (GRCm39) probably null Het
Prl7c1 A G 13: 27,957,709 (GRCm39) S244P possibly damaging Het
Rpap1 G T 2: 119,607,377 (GRCm39) probably null Het
Rrp8 G A 7: 105,383,325 (GRCm39) R314* probably null Het
Smarca4 T A 9: 21,590,445 (GRCm39) probably null Het
Stambpl1 A G 19: 34,211,520 (GRCm39) probably null Het
Tmeff2 T C 1: 51,220,985 (GRCm39) V320A probably damaging Het
Top2b A G 14: 16,416,671 (GRCm38) K83E probably damaging Het
Ttc39b C G 4: 83,148,730 (GRCm39) V560L probably benign Het
Ttn A T 2: 76,672,153 (GRCm39) probably benign Het
Usp32 T C 11: 84,913,107 (GRCm39) I934V probably benign Het
Uxs1 T C 1: 43,836,410 (GRCm39) I122V probably damaging Het
Vmn1r168 A G 7: 23,240,944 (GRCm39) N267S probably benign Het
Vmn2r16 A G 5: 109,488,119 (GRCm39) N331D probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGCATCTTCCCAGCCTCTG -3'
(R):5'- CTGGAATCGTCCTCTTCGATG -3'

Sequencing Primer
(F):5'- GTACCCTGGAACTCACTGTGTAG -3'
(R):5'- GGAATCGTCCTCTTCGATGATGAC -3'
Posted On 2018-04-27