Incidental Mutation 'R6353:Vmn1r168'
ID512295
Institutional Source Beutler Lab
Gene Symbol Vmn1r168
Ensembl Gene ENSMUSG00000074291
Gene Namevomeronasal 1 receptor 168
SynonymsGm10659
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6353 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23540720-23541649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23541519 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 267 (N267S)
Ref Sequence ENSEMBL: ENSMUSP00000096301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098704]
Predicted Effect probably benign
Transcript: ENSMUST00000098704
AA Change: N267S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096301
Gene: ENSMUSG00000074291
AA Change: N267S

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1.1e-12 PFAM
Pfam:V1R 41 295 2.5e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik C A 9: 53,414,342 Q60K probably benign Het
Aamp T C 1: 74,280,828 D397G probably benign Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Acta1 T C 8: 123,893,687 E4G probably benign Het
Apob A T 12: 8,009,421 K2601N probably damaging Het
Arpin C A 7: 79,935,345 probably benign Het
Asnsd1 T C 1: 53,347,779 I230V probably benign Het
Baiap2l1 C T 5: 144,282,088 E237K possibly damaging Het
Chek1 T C 9: 36,723,959 K43E probably benign Het
Clec2g T A 6: 128,982,932 probably null Het
Cnot10 A G 9: 114,597,546 L646P probably damaging Het
Cyp2j9 T C 4: 96,585,898 T102A probably benign Het
Dnase1l2 A T 17: 24,442,245 L30Q probably damaging Het
Edc3 T C 9: 57,716,237 S152P probably benign Het
Fam198b A T 3: 79,941,340 R464S probably damaging Het
Gm5538 A T 3: 59,752,108 L327F probably damaging Het
Gpr160 A T 3: 30,896,022 D81V probably damaging Het
Intu A T 3: 40,653,708 D32V probably damaging Het
Itga5 T C 15: 103,352,523 E512G probably damaging Het
Khnyn T C 14: 55,894,303 F561L possibly damaging Het
Kmt2e T A 5: 23,493,245 V645E probably damaging Het
Mcoln3 T C 3: 146,131,154 F247S probably damaging Het
Mettl11b A G 1: 163,704,111 Y158H possibly damaging Het
Nek9 G A 12: 85,301,829 T977I probably damaging Het
Nphs1 A G 7: 30,474,544 T1015A probably damaging Het
Nudcd1 T C 15: 44,420,762 Y76C probably damaging Het
Olfr441 C A 6: 43,116,136 Y131* probably null Het
Olfr907 T C 9: 38,498,816 I49T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prl7c1 A G 13: 27,773,726 S244P possibly damaging Het
Rpap1 G T 2: 119,776,896 probably null Het
Rrp8 G A 7: 105,734,118 R314* probably null Het
Smarca4 T A 9: 21,679,149 probably null Het
Stambpl1 A G 19: 34,234,120 probably null Het
Tmeff2 T C 1: 51,181,826 V320A probably damaging Het
Top2b A G 14: 16,416,671 K83E probably damaging Het
Ttc39b C G 4: 83,230,493 V560L probably benign Het
Ttn A T 2: 76,841,809 probably benign Het
Usp32 T C 11: 85,022,281 I934V probably benign Het
Uxs1 T C 1: 43,797,250 I122V probably damaging Het
Vmn2r16 A G 5: 109,340,253 N331D probably benign Het
Other mutations in Vmn1r168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Vmn1r168 APN 7 23541645 missense possibly damaging 0.73
IGL02621:Vmn1r168 APN 7 23541355 missense probably damaging 1.00
IGL02650:Vmn1r168 APN 7 23541491 missense probably benign 0.13
PIT4466001:Vmn1r168 UTSW 7 23540996 missense probably damaging 1.00
R0320:Vmn1r168 UTSW 7 23541342 missense probably benign 0.12
R1595:Vmn1r168 UTSW 7 23541195 missense probably damaging 1.00
R1618:Vmn1r168 UTSW 7 23541300 missense probably benign 0.02
R1808:Vmn1r168 UTSW 7 23540759 missense probably benign 0.05
R2418:Vmn1r168 UTSW 7 23541399 missense probably benign 0.05
R2419:Vmn1r168 UTSW 7 23541399 missense probably benign 0.05
R4846:Vmn1r168 UTSW 7 23541065 missense probably damaging 1.00
R4864:Vmn1r168 UTSW 7 23541482 missense probably damaging 0.98
R5269:Vmn1r168 UTSW 7 23541414 missense probably benign 0.40
R6265:Vmn1r168 UTSW 7 23541536 missense probably benign
R6768:Vmn1r168 UTSW 7 23541035 missense probably damaging 1.00
R6921:Vmn1r168 UTSW 7 23540898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATAGACACTACCAGAGACTGC -3'
(R):5'- TCTTTGGCTGGTATAAGAGAAGAGG -3'

Sequencing Primer
(F):5'- AGAGACTGCAGTACATTTTCCC -3'
(R):5'- GCACTACCTCAGGTCATGTAGTG -3'
Posted On2018-04-27