Incidental Mutation 'R6353:Nphs1'
ID512296
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6353 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30474544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1015 (T1015A)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: T1015A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: T1015A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123880
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: T1001A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: T1001A

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik C A 9: 53,414,342 Q60K probably benign Het
Aamp T C 1: 74,280,828 D397G probably benign Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Acta1 T C 8: 123,893,687 E4G probably benign Het
Apob A T 12: 8,009,421 K2601N probably damaging Het
Arpin C A 7: 79,935,345 probably benign Het
Asnsd1 T C 1: 53,347,779 I230V probably benign Het
Baiap2l1 C T 5: 144,282,088 E237K possibly damaging Het
Chek1 T C 9: 36,723,959 K43E probably benign Het
Clec2g T A 6: 128,982,932 probably null Het
Cnot10 A G 9: 114,597,546 L646P probably damaging Het
Cyp2j9 T C 4: 96,585,898 T102A probably benign Het
Dnase1l2 A T 17: 24,442,245 L30Q probably damaging Het
Edc3 T C 9: 57,716,237 S152P probably benign Het
Fam198b A T 3: 79,941,340 R464S probably damaging Het
Gm5538 A T 3: 59,752,108 L327F probably damaging Het
Gpr160 A T 3: 30,896,022 D81V probably damaging Het
Intu A T 3: 40,653,708 D32V probably damaging Het
Itga5 T C 15: 103,352,523 E512G probably damaging Het
Khnyn T C 14: 55,894,303 F561L possibly damaging Het
Kmt2e T A 5: 23,493,245 V645E probably damaging Het
Mcoln3 T C 3: 146,131,154 F247S probably damaging Het
Mettl11b A G 1: 163,704,111 Y158H possibly damaging Het
Nek9 G A 12: 85,301,829 T977I probably damaging Het
Nudcd1 T C 15: 44,420,762 Y76C probably damaging Het
Olfr441 C A 6: 43,116,136 Y131* probably null Het
Olfr907 T C 9: 38,498,816 I49T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prl7c1 A G 13: 27,773,726 S244P possibly damaging Het
Rpap1 G T 2: 119,776,896 probably null Het
Rrp8 G A 7: 105,734,118 R314* probably null Het
Smarca4 T A 9: 21,679,149 probably null Het
Stambpl1 A G 19: 34,234,120 probably null Het
Tmeff2 T C 1: 51,181,826 V320A probably damaging Het
Top2b A G 14: 16,416,671 K83E probably damaging Het
Ttc39b C G 4: 83,230,493 V560L probably benign Het
Ttn A T 2: 76,841,809 probably benign Het
Usp32 T C 11: 85,022,281 I934V probably benign Het
Uxs1 T C 1: 43,797,250 I122V probably damaging Het
Vmn1r168 A G 7: 23,541,519 N267S probably benign Het
Vmn2r16 A G 5: 109,340,253 N331D probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCCTCAGAGGTTCCAAATC -3'
(R):5'- ATGCCATCCCACAAGATGTC -3'

Sequencing Primer
(F):5'- CCTCAGAGGTTCCAAATCAGGTG -3'
(R):5'- TGCCATCCCACAAGATGTCAAAAAC -3'
Posted On2018-04-27