Mutagenetix > Incidental Mutation

Incidental Mutation 'R6353:Apob'

512307

Institutional Source

Beutler Lab

Gene Symbol

Apob

Ensembl Gene

ENSMUSG00000020609

Gene Name

apolipoprotein B

Synonyms

apob-100, apob-48

MMRRC Submission

044505-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.859) question?

Stock #

R6353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8027648-8066835 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8059421 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 2601 (K2601N)

Ref Sequence

ENSEMBL: ENSMUSP00000035761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000037520
AA Change: K2601N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: K2601N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	33	585	6.03e-94	SMART
DUF1943	619	932	7.88e-97	SMART
Pfam:DUF1081	945	1059	9.4e-32	PFAM
low complexity region	1100	1109	N/A	INTRINSIC
Blast:LPD_N	1249	1311	9e-22	BLAST
low complexity region	1632	1644	N/A	INTRINSIC
internal_repeat_1	1882	2038	6.61e-9	PROSPERO
SCOP:d1gw5a_	2105	2577	9e-5	SMART
internal_repeat_1	2973	3150	6.61e-9	PROSPERO
low complexity region	3561	3580	N/A	INTRINSIC
low complexity region	3928	3936	N/A	INTRINSIC
Pfam:ApoB100_C	4401	4456	5.6e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000037811
AA Change: K2634N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: K2634N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	46	598	6.03e-94	SMART
DUF1943	632	945	7.88e-97	SMART
Pfam:DUF1081	960	1070	6.3e-39	PFAM
low complexity region	1113	1122	N/A	INTRINSIC
Blast:LPD_N	1282	1344	1e-21	BLAST
low complexity region	1665	1677	N/A	INTRINSIC
internal_repeat_1	1915	2071	6.6e-9	PROSPERO
SCOP:d1gw5a_	2138	2610	9e-5	SMART
internal_repeat_1	3006	3183	6.6e-9	PROSPERO
low complexity region	3594	3613	N/A	INTRINSIC
low complexity region	3961	3969	N/A	INTRINSIC
Pfam:ApoB100_C	4434	4490	1.6e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171239

SMART Domains

Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

Domain	Start	End	E-Value	Type
low complexity region	348	356	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	C	A	9: 53,325,642 (GRCm39)	Q60K	probably benign	Het
Aadacl2fm2	A	T	3: 59,659,529 (GRCm39)	L327F	probably damaging	Het
Aamp	T	C	1: 74,319,987 (GRCm39)	D397G	probably benign	Het
Aco1	G	A	4: 40,186,367 (GRCm39)	R593Q	probably benign	Het
Acta1	T	C	8: 124,620,426 (GRCm39)	E4G	probably benign	Het
Arpin	C	A	7: 79,585,093 (GRCm39)		probably benign	Het
Asnsd1	T	C	1: 53,386,938 (GRCm39)	I230V	probably benign	Het
Baiap2l1	C	T	5: 144,218,898 (GRCm39)	E237K	possibly damaging	Het
Chek1	T	C	9: 36,635,255 (GRCm39)	K43E	probably benign	Het
Clec2g	T	A	6: 128,959,895 (GRCm39)		probably null	Het
Cnot10	A	G	9: 114,426,614 (GRCm39)	L646P	probably damaging	Het
Cyp2j9	T	C	4: 96,474,135 (GRCm39)	T102A	probably benign	Het
Dnase1l2	A	T	17: 24,661,219 (GRCm39)	L30Q	probably damaging	Het
Edc3	T	C	9: 57,623,520 (GRCm39)	S152P	probably benign	Het
Gask1b	A	T	3: 79,848,647 (GRCm39)	R464S	probably damaging	Het
Gpr160	A	T	3: 30,950,171 (GRCm39)	D81V	probably damaging	Het
Intu	A	T	3: 40,608,138 (GRCm39)	D32V	probably damaging	Het
Itga5	T	C	15: 103,260,950 (GRCm39)	E512G	probably damaging	Het
Khnyn	T	C	14: 56,131,760 (GRCm39)	F561L	possibly damaging	Het
Kmt2e	T	A	5: 23,698,243 (GRCm39)	V645E	probably damaging	Het
Mcoln3	T	C	3: 145,836,909 (GRCm39)	F247S	probably damaging	Het
Nek9	G	A	12: 85,348,603 (GRCm39)	T977I	probably damaging	Het
Nphs1	A	G	7: 30,173,969 (GRCm39)	T1015A	probably damaging	Het
Ntmt2	A	G	1: 163,531,680 (GRCm39)	Y158H	possibly damaging	Het
Nudcd1	T	C	15: 44,284,158 (GRCm39)	Y76C	probably damaging	Het
Or2a54	C	A	6: 43,093,070 (GRCm39)	Y131*	probably null	Het
Or8b44	T	C	9: 38,410,112 (GRCm39)	I49T	probably benign	Het
Pgd	C	T	4: 149,245,209 (GRCm39)		probably null	Het
Prl7c1	A	G	13: 27,957,709 (GRCm39)	S244P	possibly damaging	Het
Rpap1	G	T	2: 119,607,377 (GRCm39)		probably null	Het
Rrp8	G	A	7: 105,383,325 (GRCm39)	R314*	probably null	Het
Smarca4	T	A	9: 21,590,445 (GRCm39)		probably null	Het
Stambpl1	A	G	19: 34,211,520 (GRCm39)		probably null	Het
Tmeff2	T	C	1: 51,220,985 (GRCm39)	V320A	probably damaging	Het
Top2b	A	G	14: 16,416,671 (GRCm38)	K83E	probably damaging	Het
Ttc39b	C	G	4: 83,148,730 (GRCm39)	V560L	probably benign	Het
Ttn	A	T	2: 76,672,153 (GRCm39)		probably benign	Het
Usp32	T	C	11: 84,913,107 (GRCm39)	I934V	probably benign	Het
Uxs1	T	C	1: 43,836,410 (GRCm39)	I122V	probably damaging	Het
Vmn1r168	A	G	7: 23,240,944 (GRCm39)	N267S	probably benign	Het
Vmn2r16	A	G	5: 109,488,119 (GRCm39)	N331D	probably benign	Het

Other mutations in Apob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Apob	APN	12	8,043,065 (GRCm39)	splice site	probably benign
IGL00421:Apob	APN	12	8,060,197 (GRCm39)	missense	probably damaging	0.99
IGL00658:Apob	APN	12	8,059,471 (GRCm39)	missense	probably benign	0.08
IGL00768:Apob	APN	12	8,052,107 (GRCm39)	missense	probably damaging	1.00
IGL00833:Apob	APN	12	8,060,101 (GRCm39)	missense	probably benign	0.14
IGL00926:Apob	APN	12	8,065,421 (GRCm39)	missense	probably benign	0.01
IGL01065:Apob	APN	12	8,053,299 (GRCm39)	missense	probably damaging	0.99
IGL01313:Apob	APN	12	8,050,898 (GRCm39)	missense	probably damaging	1.00
IGL01419:Apob	APN	12	8,052,251 (GRCm39)	missense	probably damaging	0.99
IGL01461:Apob	APN	12	8,051,884 (GRCm39)	missense	probably benign	0.13
IGL02002:Apob	APN	12	8,044,822 (GRCm39)	missense	probably benign	0.03
IGL02031:Apob	APN	12	8,065,222 (GRCm39)	missense	probably benign
IGL02102:Apob	APN	12	8,039,407 (GRCm39)	missense	possibly damaging	0.94
IGL02115:Apob	APN	12	8,042,923 (GRCm39)	missense	probably benign	0.06
IGL02513:Apob	APN	12	8,042,979 (GRCm39)	missense	probably benign	0.01
IGL02967:Apob	APN	12	8,065,366 (GRCm39)	nonsense	probably null
IGL03005:Apob	APN	12	8,043,059 (GRCm39)	splice site	probably benign
IGL03011:Apob	APN	12	8,047,883 (GRCm39)	missense	probably damaging	1.00
IGL03116:Apob	APN	12	8,066,350 (GRCm39)	missense	probably damaging	0.98
IGL03215:Apob	APN	12	8,063,818 (GRCm39)	missense	possibly damaging	0.92
IGL03227:Apob	APN	12	8,066,089 (GRCm39)	missense	probably benign	0.04
Aesthete	UTSW	12	8,060,080 (GRCm39)	nonsense	probably null
Essence	UTSW	12	8,057,769 (GRCm39)	nonsense	probably null
Ethos	UTSW	12	8,040,394 (GRCm39)	missense	probably null	1.00
IGL02835:Apob	UTSW	12	8,065,097 (GRCm39)	missense	possibly damaging	0.86
IGL02837:Apob	UTSW	12	8,055,102 (GRCm39)	missense	probably damaging	1.00
R0071:Apob	UTSW	12	8,052,111 (GRCm39)	missense	probably damaging	0.98
R0071:Apob	UTSW	12	8,052,111 (GRCm39)	missense	probably damaging	0.98
R0116:Apob	UTSW	12	8,039,113 (GRCm39)	unclassified	probably benign
R0180:Apob	UTSW	12	8,058,285 (GRCm39)	nonsense	probably null
R0288:Apob	UTSW	12	8,040,779 (GRCm39)	nonsense	probably null
R0295:Apob	UTSW	12	8,052,181 (GRCm39)	nonsense	probably null
R0305:Apob	UTSW	12	8,062,210 (GRCm39)	missense	probably damaging	1.00
R0312:Apob	UTSW	12	8,059,034 (GRCm39)	missense	probably benign
R0324:Apob	UTSW	12	8,060,521 (GRCm39)	missense	probably benign	0.41
R0326:Apob	UTSW	12	8,040,307 (GRCm39)	missense	probably damaging	1.00
R0363:Apob	UTSW	12	8,060,136 (GRCm39)	missense	probably damaging	1.00
R0390:Apob	UTSW	12	8,038,678 (GRCm39)	missense	probably damaging	0.99
R0462:Apob	UTSW	12	8,050,896 (GRCm39)	missense	probably damaging	1.00
R0471:Apob	UTSW	12	8,040,406 (GRCm39)	missense	probably damaging	1.00
R0532:Apob	UTSW	12	8,066,188 (GRCm39)	missense	possibly damaging	0.48
R0548:Apob	UTSW	12	8,056,282 (GRCm39)	missense	probably damaging	1.00
R0560:Apob	UTSW	12	8,055,101 (GRCm39)	missense	probably damaging	1.00
R0595:Apob	UTSW	12	8,058,369 (GRCm39)	missense	probably benign	0.01
R0600:Apob	UTSW	12	8,056,440 (GRCm39)	missense	probably damaging	1.00
R0626:Apob	UTSW	12	8,066,193 (GRCm39)	missense	probably benign	0.45
R0685:Apob	UTSW	12	8,060,742 (GRCm39)	missense	probably benign
R0765:Apob	UTSW	12	8,066,518 (GRCm39)	missense	probably benign
R0790:Apob	UTSW	12	8,060,245 (GRCm39)	missense	probably damaging	1.00
R0918:Apob	UTSW	12	8,033,941 (GRCm39)	missense	probably benign	0.10
R0962:Apob	UTSW	12	8,039,191 (GRCm39)	missense	probably damaging	0.98
R1055:Apob	UTSW	12	8,044,963 (GRCm39)	missense	probably damaging	1.00
R1077:Apob	UTSW	12	8,056,017 (GRCm39)	missense	probably benign
R1143:Apob	UTSW	12	8,062,354 (GRCm39)	missense	probably benign	0.26
R1163:Apob	UTSW	12	8,061,654 (GRCm39)	missense	probably damaging	1.00
R1266:Apob	UTSW	12	8,056,093 (GRCm39)	missense	probably benign	0.37
R1434:Apob	UTSW	12	8,059,715 (GRCm39)	missense	probably damaging	1.00
R1442:Apob	UTSW	12	8,036,165 (GRCm39)	missense	probably benign	0.31
R1445:Apob	UTSW	12	8,066,084 (GRCm39)	missense	possibly damaging	0.48
R1459:Apob	UTSW	12	8,061,937 (GRCm39)	missense	possibly damaging	0.92
R1459:Apob	UTSW	12	8,056,047 (GRCm39)	missense	probably benign
R1465:Apob	UTSW	12	8,061,421 (GRCm39)	missense	possibly damaging	0.91
R1465:Apob	UTSW	12	8,061,421 (GRCm39)	missense	possibly damaging	0.91
R1508:Apob	UTSW	12	8,061,481 (GRCm39)	missense	possibly damaging	0.92
R1518:Apob	UTSW	12	8,039,207 (GRCm39)	missense	probably benign	0.01
R1531:Apob	UTSW	12	8,047,880 (GRCm39)	missense	possibly damaging	0.65
R1547:Apob	UTSW	12	8,053,368 (GRCm39)	missense	probably benign	0.08
R1574:Apob	UTSW	12	8,040,839 (GRCm39)	missense	possibly damaging	0.51
R1574:Apob	UTSW	12	8,040,839 (GRCm39)	missense	possibly damaging	0.51
R1682:Apob	UTSW	12	8,062,365 (GRCm39)	missense	probably benign	0.00
R1709:Apob	UTSW	12	8,059,306 (GRCm39)	missense	probably damaging	0.98
R1718:Apob	UTSW	12	8,066,087 (GRCm39)	missense	probably benign	0.02
R1752:Apob	UTSW	12	8,038,766 (GRCm39)	missense	probably benign	0.01
R1781:Apob	UTSW	12	8,059,603 (GRCm39)	missense	possibly damaging	0.96
R1818:Apob	UTSW	12	8,063,064 (GRCm39)	missense	possibly damaging	0.93
R1818:Apob	UTSW	12	8,056,834 (GRCm39)	missense	probably damaging	0.98
R1842:Apob	UTSW	12	8,061,559 (GRCm39)	missense	probably damaging	1.00
R1843:Apob	UTSW	12	8,057,602 (GRCm39)	missense	possibly damaging	0.65
R1853:Apob	UTSW	12	8,060,928 (GRCm39)	nonsense	probably null
R1990:Apob	UTSW	12	8,051,039 (GRCm39)	missense	probably damaging	1.00
R2016:Apob	UTSW	12	8,057,751 (GRCm39)	missense	possibly damaging	0.48
R2017:Apob	UTSW	12	8,057,751 (GRCm39)	missense	possibly damaging	0.48
R2023:Apob	UTSW	12	8,061,090 (GRCm39)	missense	probably benign	0.01
R2037:Apob	UTSW	12	8,057,488 (GRCm39)	missense	probably benign	0.37
R2054:Apob	UTSW	12	8,063,134 (GRCm39)	missense	probably damaging	1.00
R2057:Apob	UTSW	12	8,052,164 (GRCm39)	nonsense	probably null
R2085:Apob	UTSW	12	8,062,240 (GRCm39)	missense	probably damaging	1.00
R2159:Apob	UTSW	12	8,060,081 (GRCm39)	missense	probably benign	0.12
R2209:Apob	UTSW	12	8,057,752 (GRCm39)	missense	probably benign	0.28
R2249:Apob	UTSW	12	8,057,499 (GRCm39)	missense	probably damaging	1.00
R2254:Apob	UTSW	12	8,061,256 (GRCm39)	missense	possibly damaging	0.92
R2265:Apob	UTSW	12	8,065,475 (GRCm39)	missense	possibly damaging	0.74
R2266:Apob	UTSW	12	8,065,475 (GRCm39)	missense	possibly damaging	0.74
R2267:Apob	UTSW	12	8,065,475 (GRCm39)	missense	possibly damaging	0.74
R2268:Apob	UTSW	12	8,065,475 (GRCm39)	missense	possibly damaging	0.74
R2296:Apob	UTSW	12	8,044,879 (GRCm39)	missense	probably damaging	0.97
R2897:Apob	UTSW	12	8,060,356 (GRCm39)	missense	probably damaging	1.00
R3431:Apob	UTSW	12	8,060,778 (GRCm39)	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8,056,327 (GRCm39)	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8,061,763 (GRCm39)	missense	possibly damaging	0.46
R3899:Apob	UTSW	12	8,065,849 (GRCm39)	missense	possibly damaging	0.87
R4020:Apob	UTSW	12	8,044,914 (GRCm39)	nonsense	probably null
R4050:Apob	UTSW	12	8,065,390 (GRCm39)	missense	probably benign	0.02
R4351:Apob	UTSW	12	8,043,054 (GRCm39)	missense	probably benign	0.03
R4365:Apob	UTSW	12	8,066,083 (GRCm39)	missense	possibly damaging	0.95
R4366:Apob	UTSW	12	8,066,083 (GRCm39)	missense	possibly damaging	0.95
R4456:Apob	UTSW	12	8,065,445 (GRCm39)	missense	probably damaging	1.00
R4458:Apob	UTSW	12	8,065,445 (GRCm39)	missense	probably damaging	1.00
R4600:Apob	UTSW	12	8,058,568 (GRCm39)	missense	probably damaging	1.00
R4611:Apob	UTSW	12	8,061,331 (GRCm39)	missense	probably damaging	1.00
R4646:Apob	UTSW	12	8,062,759 (GRCm39)	missense	probably benign	0.21
R4678:Apob	UTSW	12	8,045,585 (GRCm39)	missense	probably damaging	1.00
R4685:Apob	UTSW	12	8,056,456 (GRCm39)	missense	probably benign	0.00
R4707:Apob	UTSW	12	8,056,205 (GRCm39)	missense	probably damaging	0.96
R4726:Apob	UTSW	12	8,040,267 (GRCm39)	missense	probably damaging	0.98
R4792:Apob	UTSW	12	8,058,051 (GRCm39)	missense	probably benign	0.26
R4822:Apob	UTSW	12	8,065,741 (GRCm39)	missense	probably benign	0.04
R4834:Apob	UTSW	12	8,064,101 (GRCm39)	missense	possibly damaging	0.49
R4835:Apob	UTSW	12	8,065,391 (GRCm39)	missense	possibly damaging	0.56
R4887:Apob	UTSW	12	8,063,099 (GRCm39)	missense	probably damaging	1.00
R4910:Apob	UTSW	12	8,057,848 (GRCm39)	missense	probably damaging	1.00
R5072:Apob	UTSW	12	8,058,714 (GRCm39)	missense	probably benign	0.00
R5073:Apob	UTSW	12	8,055,219 (GRCm39)	critical splice donor site	probably null
R5074:Apob	UTSW	12	8,055,219 (GRCm39)	critical splice donor site	probably null
R5101:Apob	UTSW	12	8,061,934 (GRCm39)	missense	probably benign	0.09
R5123:Apob	UTSW	12	8,057,630 (GRCm39)	splice site	probably null
R5133:Apob	UTSW	12	8,058,898 (GRCm39)	missense	probably damaging	0.99
R5135:Apob	UTSW	12	8,060,086 (GRCm39)	missense	probably damaging	1.00
R5137:Apob	UTSW	12	8,061,384 (GRCm39)	missense	possibly damaging	0.63
R5160:Apob	UTSW	12	8,062,126 (GRCm39)	missense	possibly damaging	0.90
R5173:Apob	UTSW	12	8,058,238 (GRCm39)	missense	probably benign	0.00
R5202:Apob	UTSW	12	8,063,737 (GRCm39)	missense	probably damaging	0.98
R5229:Apob	UTSW	12	8,027,806 (GRCm39)	missense	probably benign
R5292:Apob	UTSW	12	8,055,912 (GRCm39)	missense	probably benign	0.01
R5378:Apob	UTSW	12	8,061,865 (GRCm39)	missense	probably damaging	0.99
R5494:Apob	UTSW	12	8,061,762 (GRCm39)	missense	probably damaging	0.99
R5517:Apob	UTSW	12	8,040,906 (GRCm39)	missense	probably damaging	1.00
R5576:Apob	UTSW	12	8,048,662 (GRCm39)	missense	probably damaging	1.00
R5582:Apob	UTSW	12	8,060,788 (GRCm39)	missense	probably damaging	1.00
R5629:Apob	UTSW	12	8,057,847 (GRCm39)	missense	probably damaging	1.00
R5678:Apob	UTSW	12	8,041,494 (GRCm39)	missense	possibly damaging	0.92
R5732:Apob	UTSW	12	8,060,353 (GRCm39)	missense	probably benign	0.15
R5734:Apob	UTSW	12	8,038,781 (GRCm39)	missense	probably damaging	1.00
R5742:Apob	UTSW	12	8,057,191 (GRCm39)	missense	probably damaging	1.00
R5751:Apob	UTSW	12	8,062,619 (GRCm39)	nonsense	probably null
R5776:Apob	UTSW	12	8,056,149 (GRCm39)	missense	possibly damaging	0.57
R5778:Apob	UTSW	12	8,065,074 (GRCm39)	missense	probably benign	0.45
R5783:Apob	UTSW	12	8,051,022 (GRCm39)	missense	probably damaging	1.00
R5786:Apob	UTSW	12	8,065,304 (GRCm39)	missense	possibly damaging	0.48
R5837:Apob	UTSW	12	8,053,277 (GRCm39)	missense	probably benign	0.04
R5857:Apob	UTSW	12	8,065,397 (GRCm39)	missense	probably benign	0.00
R6029:Apob	UTSW	12	8,066,243 (GRCm39)	missense	probably damaging	0.99
R6032:Apob	UTSW	12	8,045,513 (GRCm39)	missense	probably benign	0.02
R6032:Apob	UTSW	12	8,045,513 (GRCm39)	missense	probably benign	0.02
R6086:Apob	UTSW	12	8,065,164 (GRCm39)	missense	probably benign
R6110:Apob	UTSW	12	8,061,883 (GRCm39)	missense	probably damaging	1.00
R6131:Apob	UTSW	12	8,065,874 (GRCm39)	missense	probably benign	0.17
R6157:Apob	UTSW	12	8,056,077 (GRCm39)	missense	probably benign
R6179:Apob	UTSW	12	8,055,060 (GRCm39)	nonsense	probably null
R6247:Apob	UTSW	12	8,051,801 (GRCm39)	missense	probably damaging	1.00
R6279:Apob	UTSW	12	8,057,769 (GRCm39)	nonsense	probably null
R6300:Apob	UTSW	12	8,057,769 (GRCm39)	nonsense	probably null
R6320:Apob	UTSW	12	8,039,194 (GRCm39)	missense	probably benign	0.27
R6339:Apob	UTSW	12	8,066,188 (GRCm39)	missense	probably damaging	0.99
R6395:Apob	UTSW	12	8,058,507 (GRCm39)	missense	probably benign	0.45
R6441:Apob	UTSW	12	8,037,796 (GRCm39)	missense	probably damaging	1.00
R6492:Apob	UTSW	12	8,058,261 (GRCm39)	missense	probably damaging	0.99
R6495:Apob	UTSW	12	8,040,394 (GRCm39)	missense	probably null	1.00
R6502:Apob	UTSW	12	8,051,814 (GRCm39)	missense	probably damaging	0.99
R6520:Apob	UTSW	12	8,033,124 (GRCm39)	missense	probably damaging	1.00
R6644:Apob	UTSW	12	8,059,077 (GRCm39)	missense	probably damaging	0.97
R6704:Apob	UTSW	12	8,060,379 (GRCm39)	missense	probably damaging	0.98
R6750:Apob	UTSW	12	8,047,853 (GRCm39)	missense	probably damaging	1.00
R6759:Apob	UTSW	12	8,061,049 (GRCm39)	missense	probably benign	0.06
R6812:Apob	UTSW	12	8,033,062 (GRCm39)	missense	probably damaging	0.98
R6865:Apob	UTSW	12	8,058,847 (GRCm39)	missense	probably benign	0.05
R6873:Apob	UTSW	12	8,065,995 (GRCm39)	missense	probably benign	0.00
R7013:Apob	UTSW	12	8,060,080 (GRCm39)	nonsense	probably null
R7067:Apob	UTSW	12	8,059,423 (GRCm39)	missense	probably damaging	1.00
R7084:Apob	UTSW	12	8,059,591 (GRCm39)	missense	probably benign
R7113:Apob	UTSW	12	8,045,539 (GRCm39)	missense	probably damaging	1.00
R7175:Apob	UTSW	12	8,057,034 (GRCm39)	missense	probably benign	0.33
R7196:Apob	UTSW	12	8,033,893 (GRCm39)	missense	possibly damaging	0.90
R7199:Apob	UTSW	12	8,055,072 (GRCm39)	missense	probably damaging	1.00
R7205:Apob	UTSW	12	8,055,087 (GRCm39)	missense	probably damaging	0.98
R7251:Apob	UTSW	12	8,057,037 (GRCm39)	missense	probably damaging	0.98
R7474:Apob	UTSW	12	8,059,185 (GRCm39)	missense	probably benign	0.29
R7484:Apob	UTSW	12	8,056,884 (GRCm39)	nonsense	probably null
R7538:Apob	UTSW	12	8,052,219 (GRCm39)	missense	probably damaging	0.98
R7636:Apob	UTSW	12	8,059,516 (GRCm39)	missense	possibly damaging	0.86
R7646:Apob	UTSW	12	8,059,189 (GRCm39)	missense	probably damaging	0.99
R7787:Apob	UTSW	12	8,040,780 (GRCm39)	missense	probably damaging	0.97
R7793:Apob	UTSW	12	8,058,124 (GRCm39)	missense	probably damaging	0.99
R7836:Apob	UTSW	12	8,051,885 (GRCm39)	missense	possibly damaging	0.72
R7895:Apob	UTSW	12	8,061,933 (GRCm39)	missense	probably benign	0.00
R8005:Apob	UTSW	12	8,059,744 (GRCm39)	missense	probably benign	0.01
R8013:Apob	UTSW	12	8,060,798 (GRCm39)	missense	possibly damaging	0.94
R8014:Apob	UTSW	12	8,060,798 (GRCm39)	missense	possibly damaging	0.94
R8111:Apob	UTSW	12	8,058,801 (GRCm39)	missense	probably benign	0.16
R8117:Apob	UTSW	12	8,056,435 (GRCm39)	missense	probably damaging	0.99
R8226:Apob	UTSW	12	8,059,056 (GRCm39)	missense	probably benign	0.00
R8244:Apob	UTSW	12	8,060,548 (GRCm39)	missense	probably damaging	0.96
R8280:Apob	UTSW	12	8,060,851 (GRCm39)	missense	possibly damaging	0.46
R8310:Apob	UTSW	12	8,059,033 (GRCm39)	missense	probably benign	0.00
R8327:Apob	UTSW	12	8,051,015 (GRCm39)	missense	possibly damaging	0.72
R8329:Apob	UTSW	12	8,061,135 (GRCm39)	missense	probably damaging	0.98
R8331:Apob	UTSW	12	8,051,882 (GRCm39)	missense	probably benign	0.28
R8351:Apob	UTSW	12	8,056,356 (GRCm39)	missense	probably benign	0.29
R8412:Apob	UTSW	12	8,058,069 (GRCm39)	missense	probably benign	0.33
R8425:Apob	UTSW	12	8,038,842 (GRCm39)	missense	possibly damaging	0.70
R8481:Apob	UTSW	12	8,044,807 (GRCm39)	splice site	probably null
R8493:Apob	UTSW	12	8,059,009 (GRCm39)	missense	possibly damaging	0.87
R8529:Apob	UTSW	12	8,057,353 (GRCm39)	missense	probably damaging	1.00
R8554:Apob	UTSW	12	8,037,830 (GRCm39)	missense	probably damaging	0.98
R8692:Apob	UTSW	12	8,058,270 (GRCm39)	missense	probably damaging	0.98
R8695:Apob	UTSW	12	8,057,830 (GRCm39)	missense	probably damaging	1.00
R8977:Apob	UTSW	12	8,065,990 (GRCm39)	missense	probably damaging	0.99
R9016:Apob	UTSW	12	8,035,408 (GRCm39)	splice site	silent
R9020:Apob	UTSW	12	8,063,999 (GRCm39)	missense	probably damaging	1.00
R9037:Apob	UTSW	12	8,066,501 (GRCm39)	missense	probably benign	0.15
R9053:Apob	UTSW	12	8,058,954 (GRCm39)	missense	possibly damaging	0.72
R9062:Apob	UTSW	12	8,058,046 (GRCm39)	missense	possibly damaging	0.91
R9142:Apob	UTSW	12	8,062,705 (GRCm39)	missense	possibly damaging	0.95
R9180:Apob	UTSW	12	8,047,925 (GRCm39)	missense	probably damaging	1.00
R9205:Apob	UTSW	12	8,030,635 (GRCm39)	missense	probably damaging	0.99
R9248:Apob	UTSW	12	8,065,231 (GRCm39)	nonsense	probably null
R9277:Apob	UTSW	12	8,061,183 (GRCm39)	missense	probably benign	0.01
R9305:Apob	UTSW	12	8,058,053 (GRCm39)	missense	probably benign	0.04
R9358:Apob	UTSW	12	8,060,833 (GRCm39)	missense	probably benign	0.14
R9375:Apob	UTSW	12	8,029,261 (GRCm39)	missense	possibly damaging	0.91
R9385:Apob	UTSW	12	8,056,399 (GRCm39)	missense	possibly damaging	0.91
R9386:Apob	UTSW	12	8,056,629 (GRCm39)	missense	probably damaging	0.99
R9392:Apob	UTSW	12	8,057,098 (GRCm39)	missense	probably benign	0.45
R9470:Apob	UTSW	12	8,039,219 (GRCm39)	missense	possibly damaging	0.94
R9523:Apob	UTSW	12	8,052,069 (GRCm39)	missense	probably damaging	1.00
R9545:Apob	UTSW	12	8,033,890 (GRCm39)	missense	possibly damaging	0.81
R9629:Apob	UTSW	12	8,059,054 (GRCm39)	missense	probably damaging	1.00
R9702:Apob	UTSW	12	8,057,559 (GRCm39)	missense	probably damaging	0.96
R9703:Apob	UTSW	12	8,030,507 (GRCm39)	missense	probably damaging	0.99
R9719:Apob	UTSW	12	8,065,464 (GRCm39)	missense	probably benign	0.15
R9726:Apob	UTSW	12	8,056,926 (GRCm39)	missense	probably damaging	0.99
R9729:Apob	UTSW	12	8,066,125 (GRCm39)	missense	probably damaging	0.99
X0027:Apob	UTSW	12	8,057,975 (GRCm39)	missense	probably benign
Z1088:Apob	UTSW	12	8,062,936 (GRCm39)	missense	possibly damaging	0.95
Z1088:Apob	UTSW	12	8,055,945 (GRCm39)	nonsense	probably null
Z1088:Apob	UTSW	12	8,055,074 (GRCm39)	missense	possibly damaging	0.91
Z1176:Apob	UTSW	12	8,054,978 (GRCm39)	missense	probably benign	0.00
Z1176:Apob	UTSW	12	8,048,011 (GRCm39)	missense	probably damaging	1.00
Z1177:Apob	UTSW	12	8,065,249 (GRCm39)	frame shift	probably null
Z1177:Apob	UTSW	12	8,038,765 (GRCm39)	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- CCATCCAAAACTGGGCTGAG -3'
(R):5'- AGGAATGTTCACTACATCCAGGTC -3'

Sequencing Primer
(F):5'- CTGGTGGAACAAGGATTCATAGTTCC -3'
(R):5'- CTCTCAAATACATTTCTGGAAGAGGC -3'

Posted On

2018-04-27