Incidental Mutation 'R6355:Olfr1278'
ID512323
Institutional Source Beutler Lab
Gene Symbol Olfr1278
Ensembl Gene ENSMUSG00000068647
Gene Nameolfactory receptor 1278
SynonymsGA_x6K02T2Q125-72343713-72344654, MOR245-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6355 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111290136-111298886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111292885 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 206 (I206V)
Ref Sequence ENSEMBL: ENSMUSP00000150587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090330] [ENSMUST00000213516] [ENSMUST00000213727] [ENSMUST00000214669] [ENSMUST00000215210] [ENSMUST00000216229]
Predicted Effect probably benign
Transcript: ENSMUST00000090330
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087802
Gene: ENSMUSG00000068647
AA Change: I206V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 2.3e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 281 5.3e-6 PFAM
Pfam:7tm_1 41 288 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213516
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000213727
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000214669
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215210
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216229
AA Change: I206V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T G 13: 30,381,499 F182L probably benign Het
Ahnak A G 19: 9,008,762 E2470G probably benign Het
Arhgap20 T C 9: 51,843,720 W418R probably damaging Het
Arhgap29 A G 3: 122,011,258 D832G possibly damaging Het
Btbd2 A G 10: 80,645,349 F325L possibly damaging Het
Chrna10 A T 7: 102,113,085 probably null Het
Cyp26a1 T C 19: 37,698,929 I188T possibly damaging Het
Dnajc13 A G 9: 104,203,270 C871R probably damaging Het
Gm11639 T C 11: 105,005,685 S4287P probably benign Het
Gm5519 A T 19: 33,825,071 *171C probably null Het
Gnat1 C A 9: 107,677,424 V81F probably benign Het
Gorab G A 1: 163,386,569 A264V probably damaging Het
Ift172 A T 5: 31,284,157 V211E probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kif26b A C 1: 178,916,178 S1280R probably damaging Het
Lce3e C T 3: 92,967,735 probably benign Het
Magi1 A G 6: 94,283,196 Y43H probably benign Het
Mon2 T A 10: 123,022,920 M829L possibly damaging Het
Nmd3 G A 3: 69,729,347 V96I probably benign Het
Ogfod1 T C 8: 94,062,982 M437T probably benign Het
Olfr1036 T A 2: 86,074,872 I44K probably benign Het
Olfr1416 T C 1: 92,479,980 T214A probably benign Het
Pabpc2 A G 18: 39,774,392 S237G probably damaging Het
Parp4 T A 14: 56,602,300 D488E possibly damaging Het
Phldb2 C T 16: 45,825,338 M293I probably damaging Het
Poc1b G A 10: 99,129,574 E80K probably damaging Het
Prdm5 C A 6: 65,883,594 Q421K probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Ralgapa1 A G 12: 55,698,854 S1239P probably damaging Het
Robo3 A G 9: 37,418,939 V1052A possibly damaging Het
Satb2 G T 1: 56,948,197 D83E probably damaging Het
Sccpdh T C 1: 179,670,600 S70P probably benign Het
Scn3a A G 2: 65,461,299 F1701S probably damaging Het
Srsf9 A G 5: 115,327,309 M1V probably null Het
Stk32a T A 18: 43,297,594 probably null Het
Sult2a5 A C 7: 13,662,537 Y183S probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnip2 G A 5: 34,499,197 Q255* probably null Het
Vmn1r26 A G 6: 58,008,551 W218R probably benign Het
Vmn2r61 A G 7: 42,267,235 Y424C probably benign Het
Vmn2r86 T A 10: 130,455,894 M1L probably damaging Het
Wnt3a A T 11: 59,275,232 I74N probably damaging Het
Zfyve1 A T 12: 83,594,641 H80Q probably benign Het
Other mutations in Olfr1278
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1278 APN 2 111292519 missense probably benign 0.11
IGL02301:Olfr1278 APN 2 111292697 missense probably benign 0.03
IGL02480:Olfr1278 APN 2 111292513 missense possibly damaging 0.66
IGL03056:Olfr1278 APN 2 111293172 missense possibly damaging 0.90
IGL03327:Olfr1278 APN 2 111292462 missense probably damaging 1.00
R0284:Olfr1278 UTSW 2 111292586 missense probably benign 0.34
R1614:Olfr1278 UTSW 2 111293066 missense probably damaging 0.97
R1698:Olfr1278 UTSW 2 111292560 nonsense probably null
R1733:Olfr1278 UTSW 2 111292865 missense probably damaging 0.98
R2265:Olfr1278 UTSW 2 111293179 missense probably benign 0.01
R4857:Olfr1278 UTSW 2 111293143 missense possibly damaging 0.95
R5061:Olfr1278 UTSW 2 111292487 missense probably damaging 1.00
R5208:Olfr1278 UTSW 2 111292601 missense probably damaging 1.00
R5940:Olfr1278 UTSW 2 111292384 missense possibly damaging 0.80
R6820:Olfr1278 UTSW 2 111293110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCTGACCATCATGAGCC -3'
(R):5'- AGGAAATGGCCACATGTACAC -3'

Sequencing Primer
(F):5'- GCCCAAGAATGTGCCTTATG -3'
(R):5'- TGTACACAAAGATGCATGGTCC -3'
Posted On2018-04-27