Incidental Mutation 'R6355:Nmd3'
ID512324
Institutional Source Beutler Lab
Gene Symbol Nmd3
Ensembl Gene ENSMUSG00000027787
Gene NameNMD3 ribosome export adaptor
SynonymsC87860
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6355 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69721985-69756373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69729347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 96 (V96I)
Ref Sequence ENSEMBL: ENSMUSP00000142290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029358] [ENSMUST00000135266] [ENSMUST00000143041] [ENSMUST00000143249]
Predicted Effect probably benign
Transcript: ENSMUST00000029358
AA Change: V96I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787
AA Change: V96I

DomainStartEndE-ValueType
Pfam:NMD3 17 246 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127211
Predicted Effect probably benign
Transcript: ENSMUST00000135266
AA Change: V96I

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142290
Gene: ENSMUSG00000027787
AA Change: V96I

DomainStartEndE-ValueType
Pfam:NMD3 17 128 2e-31 PFAM
Predicted Effect silent
Transcript: ENSMUST00000143041
Predicted Effect probably benign
Transcript: ENSMUST00000143249
SMART Domains Protein: ENSMUSP00000115736
Gene: ENSMUSG00000027787

DomainStartEndE-ValueType
Pfam:NMD3 17 76 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194168
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T G 13: 30,381,499 F182L probably benign Het
Ahnak A G 19: 9,008,762 E2470G probably benign Het
Arhgap20 T C 9: 51,843,720 W418R probably damaging Het
Arhgap29 A G 3: 122,011,258 D832G possibly damaging Het
Btbd2 A G 10: 80,645,349 F325L possibly damaging Het
Chrna10 A T 7: 102,113,085 probably null Het
Cyp26a1 T C 19: 37,698,929 I188T possibly damaging Het
Dnajc13 A G 9: 104,203,270 C871R probably damaging Het
Gm11639 T C 11: 105,005,685 S4287P probably benign Het
Gm5519 A T 19: 33,825,071 *171C probably null Het
Gnat1 C A 9: 107,677,424 V81F probably benign Het
Gorab G A 1: 163,386,569 A264V probably damaging Het
Ift172 A T 5: 31,284,157 V211E probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kif26b A C 1: 178,916,178 S1280R probably damaging Het
Lce3e C T 3: 92,967,735 probably benign Het
Magi1 A G 6: 94,283,196 Y43H probably benign Het
Mon2 T A 10: 123,022,920 M829L possibly damaging Het
Ogfod1 T C 8: 94,062,982 M437T probably benign Het
Olfr1036 T A 2: 86,074,872 I44K probably benign Het
Olfr1278 A G 2: 111,292,885 I206V probably benign Het
Olfr1416 T C 1: 92,479,980 T214A probably benign Het
Pabpc2 A G 18: 39,774,392 S237G probably damaging Het
Parp4 T A 14: 56,602,300 D488E possibly damaging Het
Phldb2 C T 16: 45,825,338 M293I probably damaging Het
Poc1b G A 10: 99,129,574 E80K probably damaging Het
Prdm5 C A 6: 65,883,594 Q421K probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Ralgapa1 A G 12: 55,698,854 S1239P probably damaging Het
Robo3 A G 9: 37,418,939 V1052A possibly damaging Het
Satb2 G T 1: 56,948,197 D83E probably damaging Het
Sccpdh T C 1: 179,670,600 S70P probably benign Het
Scn3a A G 2: 65,461,299 F1701S probably damaging Het
Srsf9 A G 5: 115,327,309 M1V probably null Het
Stk32a T A 18: 43,297,594 probably null Het
Sult2a5 A C 7: 13,662,537 Y183S probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnip2 G A 5: 34,499,197 Q255* probably null Het
Vmn1r26 A G 6: 58,008,551 W218R probably benign Het
Vmn2r61 A G 7: 42,267,235 Y424C probably benign Het
Vmn2r86 T A 10: 130,455,894 M1L probably damaging Het
Wnt3a A T 11: 59,275,232 I74N probably damaging Het
Zfyve1 A T 12: 83,594,641 H80Q probably benign Het
Other mutations in Nmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Nmd3 APN 3 69745240 missense possibly damaging 0.63
IGL01014:Nmd3 APN 3 69726386 missense probably benign 0.00
IGL01289:Nmd3 APN 3 69724287 missense possibly damaging 0.85
IGL02566:Nmd3 APN 3 69739914 unclassified probably benign
IGL03259:Nmd3 APN 3 69745243 missense possibly damaging 0.49
IGL03299:Nmd3 APN 3 69730429 splice site probably null
IGL03382:Nmd3 APN 3 69735088 missense probably damaging 0.99
R0017:Nmd3 UTSW 3 69736092 splice site probably null
R0025:Nmd3 UTSW 3 69748321 missense probably damaging 1.00
R0350:Nmd3 UTSW 3 69743574 missense probably damaging 1.00
R1136:Nmd3 UTSW 3 69746716 splice site probably benign
R1635:Nmd3 UTSW 3 69739984 missense probably benign 0.03
R3081:Nmd3 UTSW 3 69724399 splice site probably benign
R3686:Nmd3 UTSW 3 69746762 missense probably damaging 1.00
R3758:Nmd3 UTSW 3 69724308 nonsense probably null
R4384:Nmd3 UTSW 3 69724398 splice site probably benign
R4774:Nmd3 UTSW 3 69745236 missense probably benign 0.11
R4778:Nmd3 UTSW 3 69731591 nonsense probably null
R4953:Nmd3 UTSW 3 69731637 missense possibly damaging 0.92
R5000:Nmd3 UTSW 3 69717402 unclassified probably benign
R5182:Nmd3 UTSW 3 69722468 critical splice donor site probably null
R6043:Nmd3 UTSW 3 69745247 missense probably benign
R6760:Nmd3 UTSW 3 69746837 critical splice donor site probably null
R7869:Nmd3 UTSW 3 69726417 missense probably damaging 1.00
R8024:Nmd3 UTSW 3 69729965 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCCTTCAAAGATCTTATGAGTCTA -3'
(R):5'- TCACCTAATCATGTCAGAAGACCA -3'

Sequencing Primer
(F):5'- TATGTATAGGACCTAGTGCAGCCC -3'
(R):5'- TCATGTCAGAAGACCAAAAGATAAC -3'
Posted On2018-04-27